Gene detail

Detail information of GWHGAAZE010174

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31216.1	0	RNA polymerase alpha subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68RX5\|RPOA_PANGI	1E-175	DNA-directed RNA polymerase subunit alpha {ECO:0000255\|HAMAP-Rule:MF_00059}
trEMBL	tr\|D3WBT4\|D3WBT4_LONJA	0	RNA polymerase alpha subunit protein {ECO:0000313\|EMBL:ADD31216.1}
TAIR10	ATCG00740.1	6E-122	RNA polymerase subunit alpha

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123896148	123896924	+
GWHAAZE00000002	mRNA	123896148	123896924	+
GWHAAZE00000002	exon	123896148	123896924	+
GWHAAZE00000002	CDS	123896148	123896924	+

Transcript Sequence
>GWHTAAZE010186 ATGGTTCAAGAGAAAGTAACAGTATCTACTCGGACACTAGAGTGGAAGTGCGTTGAATCAAGAGCAGACAGTAAGCGTCTTTATTATGGACGCTTTATTCTGTCTCCACTTATGAAAGGTCAAGCTGACACAATAGGCATTGCGATGCGAAGAGCTTTGCTTGGAGAAATAGAAGGAACATGCATCACACGCGCAAAATCTGAGAAAATACCACATGAATATTCTACCATAGTGGGTATTCAAGAATCAGTACATGAAATTTTAATGAATTTGAAAGAAATTGTATTGAGAAGTAATCTATATGGAACCTGCGACGCGTCCATTTGTGTCAGGGGTCCCGGAAATGTAACTGCTCAAGATATCATCTCACCGCCCTATGTCGAAATCATTGATAATACACAGCATATAGTTAGCTTGACGGAACCAATTGATTTTTGTATTGGATTACAAATCGAGAGGAATCGTGGATATCTTATAAAAACGCCAAATCATTTTCAAGATGGAAGTTATCCCATAGATGCTGTATTCATGCCTGTTCGAAATGCGAATCATAGTATTCATTCTTATGGGAATGAGAATGAGAAACAAGAAATACTCTTTCTCGAAATATGGACAAACGGAAGTTTAACTCCTAAAGAAGCACTTCATGAAGCCTCTCGGAATTTGATTGATTTATTTATTCCTTTTTTACATACAGAAGAAGAAAATTTACATTTAGAGGACAATCAACACACGGTTCCTTTAACCCCTTTACCTTTCATGAGAAATTACAACTAA

Network for GWHGAAZE010174

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0053

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01193.25	RNA_pol_L	35	225	3.20E-12
PF01000.27	RNA_pol_A_bac	66	157	1.10E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03040	rpoA	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity
GO:0046983	molecular_function	protein dimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.616
	SRR3591706	second leaf	0.452
	SRR3591707	mature leaf	1.021
	SRR3591708	Shoot apex	0.899
	SRR3591709	Stem	0.238
	SRR3591710	White floral bud	0.281
	SRR3591711	White flower	0.306
	SRR3591712	Green floral bud	0.500
	SRR3591713	Yellow flower	0.377
SRP173429	SRR8316895	Juvenile bud stage	4.362
	SRR8316896	Juvenile bud stage	2.391
	SRR8316897	Juvenile bud stage	7.249
	SRR8316894	Third green stage	6.775
	SRR8316900	Third green stage	1.438
	SRR8316901	Third green stage	0.819
	SRR8316898	Complete white stage	1.245
	SRR8316899	Complete white stage	0.660
	SRR8316903	Complete white stage	1.373
	SRR8316902	Silver flowering stage	2.325
	SRR8316904	Silver flowering stage	2.645
	SRR8316905	Silver flowering stage	2.899
	SRR8316906	Gold flowering stage	0.668
	SRR8316907	Gold flowering stage	0.657
	SRR8316908	Gold flowering stage	0.503
SRP132670	SRR6706286	Control	0.380
	SRR6706287	Light intensity 50%	0.574
	SRR6706288	Light intensity 20%	0.525
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.084
	CNS0095593	Slightly white alabastrum(diploid) 2	2.718
	CNS0095594	Slightly white alabastrum(diploid) 3	2.836
	CNS0095595	Whole white alabastrum(diploid) 2	6.306
	CNS0095596	Whole white alabastrum(diploid) 3	3.484
	CNS0095597	Whole white alabastrum(diploid) 4	5.059
	CNS0095598	Silvery flower (diploied) 1	3.248
	CNS0095599	Silvery flower (diploied) 2	2.747
	CNS0095600	Silvery flower (diploied) 3	2.059
	CNS0095601	Golden flower (diploid) 1	4.117
	CNS0095602	Golden flower (diploid) 2	1.972
	CNS0095603	Golden flower (diploid) 3	1.865
	CNS0095604	Slightly white alabastrum(tetraploid) 1	3.443
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.548
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.490
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.030
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.255
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.256
	CNS0095610	Silvery flower (tetraploid) 1	1.799
	CNS0095611	Silvery flower (tetraploid) 2	2.791
	CNS0095612	Silvery flower (tetraploid) 3	1.763
	CNS0095613	Golden flower (tetraploid) 1	2.127
	CNS0095614	Golden flower (tetraploid) 2	2.106
	CNS0095615	Golden flower (tetraploid) 3	2.539
CRA001975	CRR073297	Stem 1	3.584
	CRR073298	Stem 2	5.234
	CRR073299	Stem 3	2.075
	CRR073300	Leaf 1	2.776
	CRR073301	Leaf 2	3.174
	CRR073302	Leaf 3	2.490
	CRR073303	Juvenile bud 1	2.511
	CRR073304	Juvenile bud 2	1.930
	CRR073305	Juvenile bud 3	2.721
	CRR073306	Third green 1	2.158
	CRR073307	Third green 2	1.048
	CRR073308	Third green 3	2.234
	CRR073309	Second white 1	1.727
	CRR073310	Second white 2	6.745
	CRR073311	Second white 3	10.416
	CRR073312	Silver flowering 1	5.429
	CRR073313	Silver flowering 2	1.146
	CRR073314	Silver flowering 3	4.660
	CRR073315	Gold flowering 1	7.157
	CRR073316	Gold flowering 2	8.533
	CRR073317	Gold flowering 3	5.501
	CRR073318	Tawny withering 1	2.873
	CRR073319	Tawny withering 2	3.095
	CRR073320	Tawny withering 3	1.419