Gene detail

Detail information of GWHGAAZE010175

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	YP_001001565.1	1.81473E-89	cytochrome b6/f complex subunit IV [Nuphar advena]
Swissprot	tr\|Q6EW21\|PETD_NYMAL	2E-91	Cytochrome b6-f complex subunit 4 {ECO:0000255\|HAMAP-Rule:MF_01344}
trEMBL	tr\|Q4FFW3\|Q4FFW3_RANMC	1E-89	Cytochrome b6/f complex subunit IV {ECO:0000313\|EMBL:AAZ04006.1} (Fragment)
TAIR10	ATCG00730.1	1E-71	photosynthetic electron transfer D

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123897377	123897778	-
GWHAAZE00000002	mRNA	123897377	123897778	-
GWHAAZE00000002	exon	123897377	123897778	-
GWHAAZE00000002	CDS	123897377	123897778	-

Transcript Sequence
>GWHTAAZE010187 ATGGGTCATAATTATTACGGAGAGCCCGCGTGGCCTAATGATCTTTTATATATTTTTCCTGTAGTCATTCTAGGTACTATTGCATGTAACGTAGGCTTAGCGGTTCTAGAACCATCAATGATTGGTGAACCAGCAGATCCATTTGCAACCCCTTTAGAAATATTACCCGAATGGTATTTCTTTCCCGTATTTCAAATACTTCGTACAGTACCCAATAAATTATTGGGTGTTCTTTTAATGGTTTCAGTACCCGCGGGATTATTAACAGTACCTTTTTTAGAGAATGTTAATAAATTTCAAAATCCATTTCGTCGTCCAGTAGCGACAACGGTCTTTTTGATTGGTACCGCAGTGGCCCTTTGGTTGGGTATTGGTGCAACATTACCTATTGATAAATCCTAA

Network for GWHGAAZE010175

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00032.18	Cytochrom_B_C	44	129	1.70E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02637	petD	Metabolic pathways	map01100
K02637	petD	Photosynthesis	map00195

Gene Ontology

GO term	Ontology	Name
GO:0009767	biological_process	photosynthetic electron transport chain
GO:0016020	cellular_component	membrane
GO:0042651	cellular_component	thylakoid membrane
GO:0009055	molecular_function	electron transfer activity
GO:0016491	molecular_function	oxidoreductase activity
GO:0045156	molecular_function	electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.513
	SRR3591706	second leaf	2.699
	SRR3591707	mature leaf	2.519
	SRR3591708	Shoot apex	1.355
	SRR3591709	Stem	0.939
	SRR3591710	White floral bud	0.512
	SRR3591711	White flower	0.143
	SRR3591712	Green floral bud	0.237
	SRR3591713	Yellow flower	0.400
SRP173429	SRR8316895	Juvenile bud stage	12.648
	SRR8316896	Juvenile bud stage	3.987
	SRR8316897	Juvenile bud stage	14.029
	SRR8316894	Third green stage	11.927
	SRR8316900	Third green stage	1.441
	SRR8316901	Third green stage	1.353
	SRR8316898	Complete white stage	6.094
	SRR8316899	Complete white stage	0.805
	SRR8316903	Complete white stage	4.130
	SRR8316902	Silver flowering stage	9.004
	SRR8316904	Silver flowering stage	8.697
	SRR8316905	Silver flowering stage	5.483
	SRR8316906	Gold flowering stage	0.945
	SRR8316907	Gold flowering stage	0.121
	SRR8316908	Gold flowering stage	0.183
SRP132670	SRR6706286	Control	0.272
	SRR6706287	Light intensity 50%	0.180
	SRR6706288	Light intensity 20%	0.260
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.899
	CNS0095593	Slightly white alabastrum(diploid) 2	4.079
	CNS0095594	Slightly white alabastrum(diploid) 3	5.703
	CNS0095595	Whole white alabastrum(diploid) 2	10.861
	CNS0095596	Whole white alabastrum(diploid) 3	5.813
	CNS0095597	Whole white alabastrum(diploid) 4	8.703
	CNS0095598	Silvery flower (diploied) 1	5.300
	CNS0095599	Silvery flower (diploied) 2	2.948
	CNS0095600	Silvery flower (diploied) 3	3.182
	CNS0095601	Golden flower (diploid) 1	3.830
	CNS0095602	Golden flower (diploid) 2	2.269
	CNS0095603	Golden flower (diploid) 3	2.245
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.479
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.173
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.402
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.418
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.972
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.619
	CNS0095610	Silvery flower (tetraploid) 1	1.614
	CNS0095611	Silvery flower (tetraploid) 2	3.249
	CNS0095612	Silvery flower (tetraploid) 3	2.401
	CNS0095613	Golden flower (tetraploid) 1	5.840
	CNS0095614	Golden flower (tetraploid) 2	3.869
	CNS0095615	Golden flower (tetraploid) 3	2.856
CRA001975	CRR073297	Stem 1	1.253
	CRR073298	Stem 2	1.796
	CRR073299	Stem 3	0.645
	CRR073300	Leaf 1	0.412
	CRR073301	Leaf 2	0.615
	CRR073302	Leaf 3	1.165
	CRR073303	Juvenile bud 1	0.422
	CRR073304	Juvenile bud 2	0.859
	CRR073305	Juvenile bud 3	1.457
	CRR073306	Third green 1	1.155
	CRR073307	Third green 2	1.782
	CRR073308	Third green 3	0.635
	CRR073309	Second white 1	1.869
	CRR073310	Second white 2	5.656
	CRR073311	Second white 3	6.826
	CRR073312	Silver flowering 1	3.649
	CRR073313	Silver flowering 2	0.668
	CRR073314	Silver flowering 3	2.431
	CRR073315	Gold flowering 1	15.355
	CRR073316	Gold flowering 2	10.312
	CRR073317	Gold flowering 3	15.203
	CRR073318	Tawny withering 1	0.798
	CRR073319	Tawny withering 2	1.241
	CRR073320	Tawny withering 3	1.773