Gene detail

Detail information of GWHGAAZE010191

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31191.1	1.98559E-96	RNA polymerase beta subunit protein (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q0ZJ28\|RPOB_VITVI	3E-92	DNA-directed RNA polymerase subunit beta {ECO:0000255\|HAMAP-Rule:MF_01321}
trEMBL	tr\|D3WBT5\|D3WBT5_LONJA	7E-97	DNA-directed RNA polymerase subunit beta {ECO:0000256\|HAMAP-Rule:MF_01321}
TAIR10	ATCG00190.1	3E-72	RNA polymerase subunit beta

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123951782	123953062	+
GWHAAZE00000002	mRNA	123951782	123953062	+
GWHAAZE00000002	exon	123951782	123951892	+
GWHAAZE00000002	exon	123952289	123952613	+
GWHAAZE00000002	exon	123952740	123953062	+
GWHAAZE00000002	CDS	123951782	123951892	+
GWHAAZE00000002	CDS	123952289	123952613	+
GWHAAZE00000002	CDS	123952740	123953062	+

Transcript Sequence
>GWHTAAZE010203 ATGGCGCCGCTACGGTTGGTGGTGAACTCGCTTTGGGGAAAACGTATTAGTAGCTTATATGCCATGGGAAGGTTACAATTTGAAGATGCAGTACTCATTAGCGAGCGCTTGAAACGTGAAATCAAAGTAGGCGATAAAGTAGTTGGAAGACATGGAAATAAGGGTATCATTTCCAAAATTTTGCCTAGACAAGATATGCCTTATTTGCAAGATGGAAGACCTGTTGATATGGTCTTCAACCCATTAGGAGTCCCTTCACGAATGAATGTAGGACAGATATTTGAATGTTCACTGGTTAGCGGGGATCTGCTAAACAGACATTATCGAATAGCGCCTTTGATGAGAGATATGAACAAGAAGCTTCGAGAAAACTTGTGTTTTCTGAATTATATGAAGCCAGTAAGCAAACAGCAAATCCATGGGTATTTGAACCCGACGGACAGTATGCCGTTGTTACACAACAAGCCGTTAGAGGAAGGTCCAGGGAGGGGACAACGGGTAGGAGAAATGGAGGTTTGGGCTCTAGAGGGATTTGGCGTTGCTCATATTTTACAAGAGATGCTTACTTATAAATCTGATCATATGAGAGCCCGACAGGGAATACTTGGTACTACACTCATCGGAGGAACAATACCTAATCCTGAGGGTGCTCCAGAATCTTTTCGATTGCTCGTTCGAGAACTACGATCTTTGGCTCTGGAATTGAATCATTTCCTTGTATCTGAGAAGAATTTCCAGATTCATAGGGAGGAAGCTTAA

Network for GWHGAAZE010191

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00562.29	RNA_pol_Rpb2_6	30	99	5.50E-33
PF04560.21	RNA_pol_Rpb2_7	164	238	1.10E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03043	rpoB	RNA polymerase	map03020

Gene Ontology

GO term	Ontology	Name
GO:0006351	biological_process	transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0003899	molecular_function	DNA-directed 5'-3' RNA polymerase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.042
	SRR3591707	mature leaf	0.022
	SRR3591708	Shoot apex	0.023
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.017
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.026
	SRR3591713	Yellow flower	0.019
SRP173429	SRR8316895	Juvenile bud stage	0.247
	SRR8316896	Juvenile bud stage	0.095
	SRR8316897	Juvenile bud stage	0.284
	SRR8316894	Third green stage	0.471
	SRR8316900	Third green stage	0.090
	SRR8316901	Third green stage	0.089
	SRR8316898	Complete white stage	0.169
	SRR8316899	Complete white stage	0.076
	SRR8316903	Complete white stage	0.134
	SRR8316902	Silver flowering stage	0.291
	SRR8316904	Silver flowering stage	0.119
	SRR8316905	Silver flowering stage	0.134
	SRR8316906	Gold flowering stage	0.011
	SRR8316907	Gold flowering stage	0.056
	SRR8316908	Gold flowering stage	0.006
SRP132670	SRR6706286	Control	0.002
	SRR6706287	Light intensity 50%	0.010
	SRR6706288	Light intensity 20%	0.005
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.199
	CNS0095593	Slightly white alabastrum(diploid) 2	0.011
	CNS0095594	Slightly white alabastrum(diploid) 3	0.221
	CNS0095595	Whole white alabastrum(diploid) 2	0.384
	CNS0095596	Whole white alabastrum(diploid) 3	0.144
	CNS0095597	Whole white alabastrum(diploid) 4	0.177
	CNS0095598	Silvery flower (diploied) 1	0.087
	CNS0095599	Silvery flower (diploied) 2	0.070
	CNS0095600	Silvery flower (diploied) 3	0.078
	CNS0095601	Golden flower (diploid) 1	0.271
	CNS0095602	Golden flower (diploid) 2	0.103
	CNS0095603	Golden flower (diploid) 3	0.044
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.103
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.137
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.156
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.150
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.277
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.076
	CNS0095610	Silvery flower (tetraploid) 1	0.144
	CNS0095611	Silvery flower (tetraploid) 2	0.057
	CNS0095612	Silvery flower (tetraploid) 3	0.077
	CNS0095613	Golden flower (tetraploid) 1	0.095
	CNS0095614	Golden flower (tetraploid) 2	0.219
	CNS0095615	Golden flower (tetraploid) 3	0.029
CRA001975	CRR073297	Stem 1	0.165
	CRR073298	Stem 2	0.165
	CRR073299	Stem 3	0.036
	CRR073300	Leaf 1	0.061
	CRR073301	Leaf 2	0.035
	CRR073302	Leaf 3	0.030
	CRR073303	Juvenile bud 1	0.025
	CRR073304	Juvenile bud 2	0.014
	CRR073305	Juvenile bud 3	0.232
	CRR073306	Third green 1	0.061
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.185
	CRR073309	Second white 1	0.175
	CRR073310	Second white 2	0.299
	CRR073311	Second white 3	0.461
	CRR073312	Silver flowering 1	0.559
	CRR073313	Silver flowering 2	0.147
	CRR073314	Silver flowering 3	0.107
	CRR073315	Gold flowering 1	0.224
	CRR073316	Gold flowering 2	0.177
	CRR073317	Gold flowering 3	0.100
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.318
	CRR073320	Tawny withering 3	0.202