Gene detail

Detail information of GWHGAAZE010193

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD29956.1	7.4407E-143	ribosomal protein S2 (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q49L09\|RR2_EUCGG	4E-134	30S ribosomal protein S2, chloroplastic
trEMBL	tr\|D3WBU5\|D3WBU5_LONJA	3E-143	30S ribosomal protein S2, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_00291}
TAIR10	ATCG00160.1	2E-89	ribosomal protein S2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	123960433	123961023	+
GWHAAZE00000002	mRNA	123960433	123961023	+
GWHAAZE00000002	exon	123960433	123961023	+
GWHAAZE00000002	CDS	123960433	123961023	+

Transcript Sequence
>GWHTAAZE010205 ATGACCAGAAGGTATTGGAACATCAATTTGGAAGAGATGATGGAGGCAGGAGTTCATTTTGGCCATGGTATTAGGAAATGGAATCCTAAAATGGCACCTTATATTTCTGCAAAGCGTAAAGGTAATCATATTACAAATCTTACTAGAACTGCTCGTTTTTTATCAGAAGCTTGTAATTTAGTTTTTGATGCAGCAAGTAGGAGAAAACAATTCTTAATTGTTGGCACTAAAAAAAAAGCAGCTGATTCAGTAGCACGGGCTGCAATAAGGGCTCGGTGTCATTATGTTAATAAAAAATGGCCTGGCGGTATGTTAACGAATTGGTCCACTACAGAAATGAGACTTCATAAGTTTAGAGACTTGAGAACGCAACAAAAAACAGGGAGACTTAACCGTCTTCCGAAAAGAGATGCGGCTATGTTGAAAAGGAGATTATCTCACTTGCAAACATATTTGGGTGGGATTAAATATATGACGGGGTTACCCGATATTGTAATTGTCGTTGATCAGCACGAAGAATATACGGCCCTTCGAGAATGTATCACTTTGGGAATTCCAACAATTTGTTTAATCGATACAAATGTGACCTGA

Network for GWHGAAZE010193

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00318.21	Ribosomal_S2	13	195	3.30E-62

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02967	RP-S2, MRPS2, rpsB	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015935	cellular_component	small ribosomal subunit
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.058
	SRR3591706	second leaf	0.646
	SRR3591707	mature leaf	0.919
	SRR3591708	Shoot apex	1.941
	SRR3591709	Stem	0.998
	SRR3591710	White floral bud	0.114
	SRR3591711	White flower	0.391
	SRR3591712	Green floral bud	0.583
	SRR3591713	Yellow flower	0.158
SRP173429	SRR8316895	Juvenile bud stage	2.977
	SRR8316896	Juvenile bud stage	2.354
	SRR8316897	Juvenile bud stage	5.000
	SRR8316894	Third green stage	4.283
	SRR8316900	Third green stage	1.970
	SRR8316901	Third green stage	0.957
	SRR8316898	Complete white stage	0.721
	SRR8316899	Complete white stage	0.665
	SRR8316903	Complete white stage	1.135
	SRR8316902	Silver flowering stage	1.088
	SRR8316904	Silver flowering stage	1.259
	SRR8316905	Silver flowering stage	1.224
	SRR8316906	Gold flowering stage	0.426
	SRR8316907	Gold flowering stage	0.415
	SRR8316908	Gold flowering stage	0.347
SRP132670	SRR6706286	Control	0.154
	SRR6706287	Light intensity 50%	0.140
	SRR6706288	Light intensity 20%	0.221
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.759
	CNS0095593	Slightly white alabastrum(diploid) 2	1.442
	CNS0095594	Slightly white alabastrum(diploid) 3	1.968
	CNS0095595	Whole white alabastrum(diploid) 2	2.893
	CNS0095596	Whole white alabastrum(diploid) 3	2.101
	CNS0095597	Whole white alabastrum(diploid) 4	4.490
	CNS0095598	Silvery flower (diploied) 1	2.318
	CNS0095599	Silvery flower (diploied) 2	1.514
	CNS0095600	Silvery flower (diploied) 3	1.656
	CNS0095601	Golden flower (diploid) 1	1.764
	CNS0095602	Golden flower (diploid) 2	1.367
	CNS0095603	Golden flower (diploid) 3	1.987
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.598
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.352
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.475
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.220
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.232
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.101
	CNS0095610	Silvery flower (tetraploid) 1	0.992
	CNS0095611	Silvery flower (tetraploid) 2	1.252
	CNS0095612	Silvery flower (tetraploid) 3	0.558
	CNS0095613	Golden flower (tetraploid) 1	1.540
	CNS0095614	Golden flower (tetraploid) 2	0.882
	CNS0095615	Golden flower (tetraploid) 3	1.028
CRA001975	CRR073297	Stem 1	2.109
	CRR073298	Stem 2	1.430
	CRR073299	Stem 3	0.620
	CRR073300	Leaf 1	0.614
	CRR073301	Leaf 2	0.858
	CRR073302	Leaf 3	0.634
	CRR073303	Juvenile bud 1	1.055
	CRR073304	Juvenile bud 2	0.292
	CRR073305	Juvenile bud 3	0.983
	CRR073306	Third green 1	1.475
	CRR073307	Third green 2	0.315
	CRR073308	Third green 3	1.011
	CRR073309	Second white 1	0.889
	CRR073310	Second white 2	0.799
	CRR073311	Second white 3	3.272
	CRR073312	Silver flowering 1	3.258
	CRR073313	Silver flowering 2	0.347
	CRR073314	Silver flowering 3	1.368
	CRR073315	Gold flowering 1	5.375
	CRR073316	Gold flowering 2	6.105
	CRR073317	Gold flowering 3	4.427
	CRR073318	Tawny withering 1	0.288
	CRR073319	Tawny withering 2	0.709
	CRR073320	Tawny withering 3	0.768