Gene detail

Detail information of GWHGAAZE010210

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD29919.1	5.6691E-140	ribosomal protein S4 (chloroplast) [Lonicera japonica]
Swissprot	tr\|Q68S04\|RR4_PANGI	1E-125	30S ribosomal protein S4, chloroplastic
trEMBL	tr\|D3WBU7\|D3WBU7_LONJA	2E-140	30S ribosomal protein S4, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01306}
TAIR10	ATCG00380.1	7E-91	chloroplast ribosomal protein S4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000002	gene	124051387	124051980	-
GWHAAZE00000002	mRNA	124051387	124051980	-
GWHAAZE00000002	exon	124051387	124051980	-
GWHAAZE00000002	CDS	124051387	124051980	-

Transcript Sequence
>GWHTAAZE010222 ATGTCGCGTTACCGAGGACCTCGTTTTAAAAAAATACGCCGCCTGGGGGCTTTGCCGGGACTAACTAAAAAGGGGCCTATAGGTCAATCGCGTTCCGTGAAAAAATCTCAATATCGTATTCGCCTTGAAGAAAAACAAAAATTGCGTTTTCATTATGGTCTTACAGAACGGCAATTACTTAAATATGTTCGTATCGCCGGAAAAGCCAAGGGGTCAACAGGTCAGGTTTTACTACAATTACTTGAAATGCGATTGGATAACATCCTTTTTCGATTGGGTATGGCTCCGACTATTCCCGGAGCTCGCCAATTAGTTAACCATAGACATATTTTAGTCAACGGCCGTATCGTAGATATACCAAGTTATCGCTGCAAACCCCGAGATATTATTACGGCGCGGGATGAACAAAACTCTAGAGCTCTGATTCAAAATTCTCTCAATTCATCCCCTCATAAGAAAAATAAATTGCCAAAACATTTGACTCTTCAGCCATTCCAATATAAAGGATTAGTCAATCAAATAATAGATAGTAAATGGGTCGGTTTGAAAATAAATGAATTGCTAGTCGTAGAATATTATTCTCGTCAGACTTAA

Network for GWHGAAZE010210

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0205

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00163.20	Ribosomal_S4	3	82	6.00E-21
PF01479.26	S4	83	130	4.60E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02986	RP-S4, rpsD	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0015935	cellular_component	small ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome
GO:0003723	molecular_function	RNA binding
GO:0019843	molecular_function	rRNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.337
	SRR3591706	second leaf	1.237
	SRR3591707	mature leaf	0.248
	SRR3591708	Shoot apex	1.516
	SRR3591709	Stem	0.323
	SRR3591710	White floral bud	0.106
	SRR3591711	White flower	0.178
	SRR3591712	Green floral bud	0.640
	SRR3591713	Yellow flower	0.407
SRP173429	SRR8316895	Juvenile bud stage	5.746
	SRR8316896	Juvenile bud stage	3.084
	SRR8316897	Juvenile bud stage	9.157
	SRR8316894	Third green stage	7.946
	SRR8316900	Third green stage	2.358
	SRR8316901	Third green stage	1.719
	SRR8316898	Complete white stage	3.755
	SRR8316899	Complete white stage	1.412
	SRR8316903	Complete white stage	2.739
	SRR8316902	Silver flowering stage	5.308
	SRR8316904	Silver flowering stage	5.135
	SRR8316905	Silver flowering stage	4.458
	SRR8316906	Gold flowering stage	1.427
	SRR8316907	Gold flowering stage	1.238
	SRR8316908	Gold flowering stage	1.275
SRP132670	SRR6706286	Control	0.507
	SRR6706287	Light intensity 50%	0.503
	SRR6706288	Light intensity 20%	0.364
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.858
	CNS0095593	Slightly white alabastrum(diploid) 2	18.195
	CNS0095594	Slightly white alabastrum(diploid) 3	27.345
	CNS0095595	Whole white alabastrum(diploid) 2	20.125
	CNS0095596	Whole white alabastrum(diploid) 3	13.882
	CNS0095597	Whole white alabastrum(diploid) 4	21.874
	CNS0095598	Silvery flower (diploied) 1	13.251
	CNS0095599	Silvery flower (diploied) 2	12.446
	CNS0095600	Silvery flower (diploied) 3	3.236
	CNS0095601	Golden flower (diploid) 1	14.263
	CNS0095602	Golden flower (diploid) 2	3.354
	CNS0095603	Golden flower (diploid) 3	2.909
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.857
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.568
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.577
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.668
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.831
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.472
	CNS0095610	Silvery flower (tetraploid) 1	2.588
	CNS0095611	Silvery flower (tetraploid) 2	2.338
	CNS0095612	Silvery flower (tetraploid) 3	1.993
	CNS0095613	Golden flower (tetraploid) 1	5.490
	CNS0095614	Golden flower (tetraploid) 2	2.329
	CNS0095615	Golden flower (tetraploid) 3	2.504
CRA001975	CRR073297	Stem 1	4.897
	CRR073298	Stem 2	6.630
	CRR073299	Stem 3	1.982
	CRR073300	Leaf 1	4.379
	CRR073301	Leaf 2	4.474
	CRR073302	Leaf 3	3.366
	CRR073303	Juvenile bud 1	5.419
	CRR073304	Juvenile bud 2	3.458
	CRR073305	Juvenile bud 3	5.790
	CRR073306	Third green 1	4.334
	CRR073307	Third green 2	2.011
	CRR073308	Third green 3	4.691
	CRR073309	Second white 1	5.214
	CRR073310	Second white 2	7.063
	CRR073311	Second white 3	6.367
	CRR073312	Silver flowering 1	4.563
	CRR073313	Silver flowering 2	0.363
	CRR073314	Silver flowering 3	1.947
	CRR073315	Gold flowering 1	17.579
	CRR073316	Gold flowering 2	16.859
	CRR073317	Gold flowering 3	11.233
	CRR073318	Tawny withering 1	3.241
	CRR073319	Tawny withering 2	5.860
	CRR073320	Tawny withering 3	1.615