Gene detail

Detail information of GWHGAAZE010320

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011007409.1	6.8806E-101	PREDICTED: probable hydroxyacylglutathione hydrolase 2, chloroplast isoform X2 [Populus euphratica]
Swissprot	tr\|Q9SID3\|GLO2N_ARATH	1E-93	Hydroxyacylglutathione hydrolase 2, mitochondrial (Precursor)
trEMBL	tr\|A9PAT7\|A9PAT7_POPTR	7E-101	GLYOXALASE 2-1 family protein {ECO:0000313\|EMBL:EEE90237.1}
TAIR10	AT2G31350.1	5E-66	glyoxalase 2-5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	3457249	3463548	-
GWHAAZE00000003	mRNA	3457249	3463548	-
GWHAAZE00000003	exon	3463395	3463548	-
GWHAAZE00000003	exon	3461726	3461826	-
GWHAAZE00000003	exon	3458697	3458771	-
GWHAAZE00000003	exon	3458498	3458596	-
GWHAAZE00000003	exon	3457249	3457395	-
GWHAAZE00000003	CDS	3463395	3463548	-
GWHAAZE00000003	CDS	3461726	3461826	-
GWHAAZE00000003	CDS	3458697	3458771	-
GWHAAZE00000003	CDS	3458498	3458596	-
GWHAAZE00000003	CDS	3457249	3457395	-

Transcript Sequence
>GWHTAAZE010332 CTAAGTCGCATATCTGTGTGTTTATTGCAGGTAATTGGGTCAGTAGTAGACAAGGATAGAATTCCTGGCATTGATATAGTCTTGAACGACGGTGACAAATGGATGTTTGCAGGTCATGAAGTGCTCATTATTGGAACTCCAGGTCCAACTAAAGGTCACATTAGCTTCTACTTTTCGGGATCAGGGTCGATTTTCACTGGAGACGCTTTGTTCAGCTTATCTTGTGGCAACCTTATTGAAGGATCTCCTGAGGAGATGCATTCATCCCTGAAAAAGATAAGCACGTTGCCAGATGACACAAATATATACTGCGGTCATGAATATACGTTGAGCAATTCAAAGTTTGCGATGTCTATAGAACCCGGGAATGAAGCACTCAAGTCTTATGCTTCCCACCTAGCCCATCTTCGAAACAAGGGCGTGCCAACGATTCCAACAACAGTAAAGAAGGAGAAGTCGTGCAATCCGTTCCTCCGCACCTCAAGTACAGAAATCCGGAGGTCGTTAAAGATTCCGACAGTGGCAACAGATGAACAAGTCTTGGCCACAATCCGAGAAGCAAAGGATAAGTTCTAG

Network for GWHGAAZE010320

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00753.28	Lactamase_B	19	106	6.00E-08
PF16123.6	HAGH_C	107	191	6.40E-25

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01069	gloB, gloC, HAGH	Metabolic pathways	map01100
K01069	gloB, gloC, HAGH	Pyruvate metabolism	map00620

Gene Ontology

GO term	Ontology	Name
GO:0019243	biological_process	methylglyoxal catabolic process to D-lactate via S-lactoyl-glutathione
GO:0004416	molecular_function	hydroxyacylglutathione hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	88.094
	SRR3591706	second leaf	45.774
	SRR3591707	mature leaf	45.807
	SRR3591708	Shoot apex	50.382
	SRR3591709	Stem	75.124
	SRR3591710	White floral bud	52.341
	SRR3591711	White flower	53.169
	SRR3591712	Green floral bud	70.384
	SRR3591713	Yellow flower	46.771
SRP173429	SRR8316895	Juvenile bud stage	39.946
	SRR8316896	Juvenile bud stage	52.881
	SRR8316897	Juvenile bud stage	27.803
	SRR8316894	Third green stage	19.891
	SRR8316900	Third green stage	68.226
	SRR8316901	Third green stage	71.980
	SRR8316898	Complete white stage	28.465
	SRR8316899	Complete white stage	93.571
	SRR8316903	Complete white stage	37.735
	SRR8316902	Silver flowering stage	21.932
	SRR8316904	Silver flowering stage	23.882
	SRR8316905	Silver flowering stage	7.658
	SRR8316906	Gold flowering stage	30.264
	SRR8316907	Gold flowering stage	34.606
	SRR8316908	Gold flowering stage	35.031
SRP132670	SRR6706286	Control	27.123
	SRR6706287	Light intensity 50%	28.077
	SRR6706288	Light intensity 20%	32.071
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	76.088
	CNS0095593	Slightly white alabastrum(diploid) 2	90.692
	CNS0095594	Slightly white alabastrum(diploid) 3	78.306
	CNS0095595	Whole white alabastrum(diploid) 2	68.490
	CNS0095596	Whole white alabastrum(diploid) 3	58.839
	CNS0095597	Whole white alabastrum(diploid) 4	70.328
	CNS0095598	Silvery flower (diploied) 1	48.355
	CNS0095599	Silvery flower (diploied) 2	46.839
	CNS0095600	Silvery flower (diploied) 3	40.895
	CNS0095601	Golden flower (diploid) 1	44.790
	CNS0095602	Golden flower (diploid) 2	40.203
	CNS0095603	Golden flower (diploid) 3	42.034
	CNS0095604	Slightly white alabastrum(tetraploid) 1	83.806
	CNS0095605	Slightly white alabastrum(tetraploid) 2	72.666
	CNS0095606	Slightly white alabastrum(tetraploid) 3	84.560
	CNS0095607	Whole white alabastrum(tetraploid) 1	70.580
	CNS0095608	Whole white alabastrum(tetraploid) 2	74.894
	CNS0095609	Whole white alabastrum(tetraploid) 3	76.562
	CNS0095610	Silvery flower (tetraploid) 1	47.232
	CNS0095611	Silvery flower (tetraploid) 2	53.381
	CNS0095612	Silvery flower (tetraploid) 3	40.032
	CNS0095613	Golden flower (tetraploid) 1	37.351
	CNS0095614	Golden flower (tetraploid) 2	39.388
	CNS0095615	Golden flower (tetraploid) 3	29.454
CRA001975	CRR073297	Stem 1	62.423
	CRR073298	Stem 2	45.035
	CRR073299	Stem 3	42.130
	CRR073300	Leaf 1	69.272
	CRR073301	Leaf 2	65.225
	CRR073302	Leaf 3	68.553
	CRR073303	Juvenile bud 1	66.298
	CRR073304	Juvenile bud 2	43.600
	CRR073305	Juvenile bud 3	47.339
	CRR073306	Third green 1	23.948
	CRR073307	Third green 2	22.161
	CRR073308	Third green 3	27.902
	CRR073309	Second white 1	16.183
	CRR073310	Second white 2	19.619
	CRR073311	Second white 3	15.695
	CRR073312	Silver flowering 1	11.710
	CRR073313	Silver flowering 2	9.917
	CRR073314	Silver flowering 3	8.148
	CRR073315	Gold flowering 1	40.434
	CRR073316	Gold flowering 2	57.211
	CRR073317	Gold flowering 3	25.561
	CRR073318	Tawny withering 1	54.271
	CRR073319	Tawny withering 2	69.941
	CRR073320	Tawny withering 3	63.372