Gene detail

Detail information of GWHGAAZE010522

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP32479.1	1.19582E-65	hypothetical protein JCGZ_13404 [Jatropha curcas]
Swissprot	tr\|Q9LKJ1\|HIBC1_ARATH	1E-62	3-hydroxyisobutyryl-CoA hydrolase 1
trEMBL	tr\|A0A067KKY6\|A0A067KKY6_JATCU	4E-66	Uncharacterized protein {ECO:0000313\|EMBL:KDP32479.1}
TAIR10	AT5G65940.2	9E-53	beta-hydroxyisobutyryl-CoA hydrolase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	11971808	11978839	-
GWHAAZE00000003	mRNA	11971808	11978839	-
GWHAAZE00000003	exon	11978765	11978839	-
GWHAAZE00000003	exon	11976176	11976239	-
GWHAAZE00000003	exon	11975577	11975656	-
GWHAAZE00000003	exon	11975277	11975434	-
GWHAAZE00000003	exon	11974567	11974646	-
GWHAAZE00000003	exon	11971808	11971944	-
GWHAAZE00000003	CDS	11978765	11978839	-
GWHAAZE00000003	CDS	11976176	11976239	-
GWHAAZE00000003	CDS	11975577	11975656	-
GWHAAZE00000003	CDS	11975277	11975434	-
GWHAAZE00000003	CDS	11974567	11974646	-
GWHAAZE00000003	CDS	11971808	11971944	-

Transcript Sequence
>GWHTAAZE010534 ATGTTGCGGAGAATAGGTGCAATGTTGGATCATGGGACATCATTTATTCCTGACCTAGAGAACCCTTCTTTTTTGGGAAAAGGAAGAGCTTTCTGTGCTGGTGGCGATGTTGCAGCTGTAGTCCGTGATATTAAGGAAGGTAATTGGAAATTAGGTGCAAAATATTTCTGGAAGGAATTCATCTTGAACTATGTGATGGCGACATACAAGAAGCCCCAGGTTTCTATTCTTTATGGAATTGTCATGGGAGGGGGAGCTGGTGCTTCAATACATGGTAGATTCCGAGTTGCAACAGAGAATTCGGTATTTGTCTCTCCCCCCTTAATTTTGAAGTACTTTTTCTTTGGTAGGAAACAAAATTCATCACTAATCAAAAGGTTTTGCAATGCCGAAACGGCTTTGGGACTCTTCCCCGATGTAGGGACTCTTATTTCTTATCAAGACTCCGGATTCTTCGGAGAATATGTTGGTCTTGCTGGTGCTAGGTTGGATGGTGCTGAGATGCTTGCATGTGGCCTTGCGACTCACTTTGTGCCCGCAGAGGTATTAATTCTTTCCGACTTTGTTATATATTTACGTGATTATTGTTCAAAG

Network for GWHGAAZE010522

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF16113.6	ECH_2	27	106	1.70E-28
PF16113.6	ECH_2	126	182	4.80E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05605	HIBCH	Metabolic pathways	map01100
		Carbon metabolism	map01200
		Propanoate metabolism	map00640
		Valine, leucine and isoleucine degradation	map00280
		beta-Alanine metabolism	map00410

Gene Ontology

GO term	Ontology	Name
GO:0003860	molecular_function	3-hydroxyisobutyryl-CoA hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.379
	SRR3591706	second leaf	0.303
	SRR3591707	mature leaf	0.132
	SRR3591708	Shoot apex	0.226
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.212
	SRR3591711	White flower	0.106
	SRR3591712	Green floral bud	0.084
	SRR3591713	Yellow flower	0.117
SRP173429	SRR8316895	Juvenile bud stage	0.177
	SRR8316896	Juvenile bud stage	0.108
	SRR8316897	Juvenile bud stage	0.647
	SRR8316894	Third green stage	0.196
	SRR8316900	Third green stage	0.578
	SRR8316901	Third green stage	0.251
	SRR8316898	Complete white stage	0.306
	SRR8316899	Complete white stage	0.595
	SRR8316903	Complete white stage	0.703
	SRR8316902	Silver flowering stage	0.074
	SRR8316904	Silver flowering stage	0.761
	SRR8316905	Silver flowering stage	0.183
	SRR8316906	Gold flowering stage	0.479
	SRR8316907	Gold flowering stage	0.106
	SRR8316908	Gold flowering stage	0.656
SRP132670	SRR6706286	Control	0.089
	SRR6706287	Light intensity 50%	0.102
	SRR6706288	Light intensity 20%	0.291
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.032
	CNS0095593	Slightly white alabastrum(diploid) 2	0.017
	CNS0095594	Slightly white alabastrum(diploid) 3	0.429
	CNS0095595	Whole white alabastrum(diploid) 2	0.181
	CNS0095596	Whole white alabastrum(diploid) 3	0.423
	CNS0095597	Whole white alabastrum(diploid) 4	0.236
	CNS0095598	Silvery flower (diploied) 1	0.042
	CNS0095599	Silvery flower (diploied) 2	0.298
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.107
	CNS0095602	Golden flower (diploid) 2	0.289
	CNS0095603	Golden flower (diploid) 3	0.314
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.003
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.507
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.483
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.314
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.343
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.832
	CNS0095610	Silvery flower (tetraploid) 1	0.589
	CNS0095611	Silvery flower (tetraploid) 2	0.479
	CNS0095612	Silvery flower (tetraploid) 3	1.746
	CNS0095613	Golden flower (tetraploid) 1	0.679
	CNS0095614	Golden flower (tetraploid) 2	0.876
	CNS0095615	Golden flower (tetraploid) 3	0.528
CRA001975	CRR073297	Stem 1	0.397
	CRR073298	Stem 2	0.126
	CRR073299	Stem 3	0.048
	CRR073300	Leaf 1	0.419
	CRR073301	Leaf 2	0.241
	CRR073302	Leaf 3	0.103
	CRR073303	Juvenile bud 1	0.348
	CRR073304	Juvenile bud 2	0.076
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.042
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.065
	CRR073309	Second white 1	0.038
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.006
	CRR073316	Gold flowering 2	0.045
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.289
	CRR073320	Tawny withering 3	0.034