Gene detail

Detail information of GWHGAAZE010536

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006354674.1	1.73619E-18	PREDICTED: 3-hydroxyisobutyryl-CoA hydrolase 1-like [Solanum tuberosum]
Swissprot	tr\|Q1PEY5\|HIBC2_ARATH	9E-13	Probable 3-hydroxyisobutyryl-CoA hydrolase 2
trEMBL	tr\|M0ZNN2\|M0ZNN2_SOLTU	3E-17	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400004585}
TAIR10	AT2G30650.1	6E-11	ATP-dependent caseinolytic (Clp) protease/crotonase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	13094630	13095105	-
GWHAAZE00000003	mRNA	13094630	13095105	-
GWHAAZE00000003	exon	13094630	13094807	-
GWHAAZE00000003	exon	13095068	13095105	-
GWHAAZE00000003	CDS	13095068	13095105	-
GWHAAZE00000003	CDS	13094630	13094807	-

Transcript Sequence
>GWHTAAZE010548 ATGGGGAGCTATACTTTAGTTCTCGAAAACACGAGGGGTTTGCTCATATTTACGGTTTTTCCCTTTCTTGTGTTTCAGTGGAATCCTTCTAAACTAGAACAAATCAGCGATGAAATGGTTGACTGTTACTTCTCCAAGGTGGATGATGAAGAATGGGAAGATCTAAAACTCCCTCCCAGGTCAAACTTGCTTGCACATGCCATTGCAAAGCTCTAG

Network for GWHGAAZE010536

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0067

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05605	HIBCH	Metabolic pathways	map01100
		Carbon metabolism	map01200
		Propanoate metabolism	map00640
		Valine, leucine and isoleucine degradation	map00280
		beta-Alanine metabolism	map00410

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.917
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	4.136
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	7.682
	SRR8316896	Juvenile bud stage	10.819
	SRR8316897	Juvenile bud stage	0.678
	SRR8316894	Third green stage	3.872
	SRR8316900	Third green stage	5.186
	SRR8316901	Third green stage	7.746
	SRR8316898	Complete white stage	2.094
	SRR8316899	Complete white stage	6.652
	SRR8316903	Complete white stage	5.551
	SRR8316902	Silver flowering stage	2.798
	SRR8316904	Silver flowering stage	4.533
	SRR8316905	Silver flowering stage	1.972
	SRR8316906	Gold flowering stage	8.528
	SRR8316907	Gold flowering stage	7.506
	SRR8316908	Gold flowering stage	2.900
SRP132670	SRR6706286	Control	0.564
	SRR6706287	Light intensity 50%	0.621
	SRR6706288	Light intensity 20%	0.690
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.832
	CNS0095593	Slightly white alabastrum(diploid) 2	8.701
	CNS0095594	Slightly white alabastrum(diploid) 3	14.469
	CNS0095595	Whole white alabastrum(diploid) 2	6.510
	CNS0095596	Whole white alabastrum(diploid) 3	9.757
	CNS0095597	Whole white alabastrum(diploid) 4	7.381
	CNS0095598	Silvery flower (diploied) 1	9.936
	CNS0095599	Silvery flower (diploied) 2	6.436
	CNS0095600	Silvery flower (diploied) 3	4.777
	CNS0095601	Golden flower (diploid) 1	8.585
	CNS0095602	Golden flower (diploid) 2	4.947
	CNS0095603	Golden flower (diploid) 3	5.628
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.153
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.806
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.938
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.557
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.660
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.388
	CNS0095610	Silvery flower (tetraploid) 1	0.636
	CNS0095611	Silvery flower (tetraploid) 2	0.937
	CNS0095612	Silvery flower (tetraploid) 3	2.046
	CNS0095613	Golden flower (tetraploid) 1	0.860
	CNS0095614	Golden flower (tetraploid) 2	0.692
	CNS0095615	Golden flower (tetraploid) 3	0.912
CRA001975	CRR073297	Stem 1	3.303
	CRR073298	Stem 2	2.155
	CRR073299	Stem 3	0.669
	CRR073300	Leaf 1	1.975
	CRR073301	Leaf 2	1.321
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.282
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.324
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.266
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	1.359
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.174
	CRR073319	Tawny withering 2	2.866
	CRR073320	Tawny withering 3	0.532