Gene detail

Detail information of GWHGAAZE010610

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008800296.1	1.28948E-84	PREDICTED: chitinase 6-like [Phoenix dactylifera]
Swissprot	tr\|Q6K8R2\|CHI6_ORYSJ	7E-74	Chitinase 6 (Precursor)
trEMBL	tr\|A0A068UT78\|A0A068UT78_COFCA	2E-83	Coffea canephora DH200=94 genomic scaffold, scaffold_48 {ECO:0000313\|EMBL:CDP10828.1}
TAIR10	AT3G54420.1	1E-62	homolog of carrot EP3-3 chitinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	15350753	15352616	+
GWHAAZE00000003	mRNA	15350753	15352616	+
GWHAAZE00000003	exon	15350753	15350843	+
GWHAAZE00000003	exon	15350909	15351103	+
GWHAAZE00000003	exon	15352183	15352616	+
GWHAAZE00000003	CDS	15350753	15350843	+
GWHAAZE00000003	CDS	15350909	15351103	+
GWHAAZE00000003	CDS	15352183	15352616	+

Transcript Sequence
>GWHTAAZE010622 ATGTCTTGCCAAAATTGGTGGCCGGTCAGAACTGTGGGTGTGCCCCAGGCTTATGTTGTAGCCAATATGGATATTGCGGCACTACCAACGGATATTGTGACAGATACGTTTTTCAATGGAATTATTAATCAAGCTATTCGAAGATGTGTTGGGAAGGGTTTTTACACTAGAGCGGCATTTCTTGAAGCTTGTGATTCGTATAGCCAATTTGGAAGGACTGGCTCCATTGATGATTCTAAGCTAGAGATTGCTGCTTTCTTTGGACATCTCATACATGAGACTGGATACTTTTGCTATATAGATGAGATTGATGGTCACAGTAAGAACTATTGCGATCCGAGTAACACGCAGTATCCCTGCATACCCGGCAAGGGATATTACGGCCGAGGTCCTCTTCAGATCAAATGGAATTACAATTACGGACCAGCCGGGAATGCCATTGGCTTCGACGGTCTAAAGAACCCTGATTTGGTGTCCTCAAATGTGGTTGTTGCTTTTAAGACTGCCTTGTGGTTCTGGATGGAGAACGTTCACTCAATCATAACTTCTGGCCAAGGGTTTGGTGAAACCATTCGTGCTTTAACGGCGGACGTGAATGTAATGGTGGAACCCCAGGTACCGTTACTGCCCGAGTCCGTTTTTACACAGATTATTGTCGCCAATTTGGTATTTCTCCTGGCAATAATCTTCGATGCTAGGGCACACTCATGTCCCTTTTAG

Network for GWHGAAZE010610

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00182.20	Glyco_hydro_19	32	176	4.00E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01183	E3.2.1.14	Metabolic pathways	map01100
K01183	E3.2.1.14	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0006032	biological_process	chitin catabolic process
GO:0016998	biological_process	cell wall macromolecule catabolic process
GO:0004568	molecular_function	chitinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.888
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	17.660
	SRR3591710	White floral bud	0.259
	SRR3591711	White flower	0.268
	SRR3591712	Green floral bud	0.087
	SRR3591713	Yellow flower	0.491
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.002
	SRR8316901	Third green stage	0.027
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.037
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.015
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.058
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.007
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.037
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.058
	CRR073302	Leaf 3	0.007
	CRR073303	Juvenile bud 1	0.006
	CRR073304	Juvenile bud 2	0.133
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.112
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.031
	CRR073309	Second white 1	0.013
	CRR073310	Second white 2	0.064
	CRR073311	Second white 3	0.022
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.022
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.027