Gene detail

Detail information of GWHGAAZE010612

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011091733.1	6.40497E-51	PREDICTED: uncharacterized protein LOC105172092 [Sesamum indicum]
Swissprot	tr\|O04138\|CHI4_ORYSJ	2E-45	Chitinase 4 (Precursor)
trEMBL	tr\|S8CHZ4\|S8CHZ4_9LAMI	2E-50	Uncharacterized protein {ECO:0000313\|EMBL:EPS66639.1} (Fragment)
TAIR10	AT3G54420.1	6E-36	homolog of carrot EP3-3 chitinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	15621536	15621922	+
GWHAAZE00000003	mRNA	15621536	15621922	+
GWHAAZE00000003	exon	15621536	15621922	+
GWHAAZE00000003	CDS	15621536	15621922	+

Transcript Sequence
>GWHTAAZE010624 ATGGTTCCGGTAAGAATTATTGCAATCCGAGTAACACGCAGTATCCGTGTACCCAGCAAGGGATATTACAGCCGAGGTCCTCTTCAGATCTCATGGAATTACAATTATGGACTGGCCGGGAATGACATTGGTTTCGATGGTCTAAACAACCCCAATATTGTGTCCTCAGATGTCGTAGTTATATTTGAGACTGCCTTCTGGTTCTGGATGGCAAACGCTCACTCACTCATAACTTCTGGCCGAGGGTTTGGTGAAACCCTTCTTGCTATTAACGGTCAACTTGAATGTAATGGTGCAAACCCAGCAACCGTTACTGCCCGAGTCAATTATGACACAGATTATTGTGGCCAATTTGGTGTTTCTCCTGGCAATAATCTTCTATGTTAG

Network for GWHGAAZE010612

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00182.20	Glyco_hydro_19	18	73	1.20E-20
PF00182.20	Glyco_hydro_19	82	128	6.60E-06

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01183	E3.2.1.14	Metabolic pathways	map01100
K01183	E3.2.1.14	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0006032	biological_process	chitin catabolic process
GO:0016998	biological_process	cell wall macromolecule catabolic process
GO:0004568	molecular_function	chitinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.622
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.557
	SRR3591709	Stem	1.214
	SRR3591710	White floral bud	0.524
	SRR3591711	White flower	0.296
	SRR3591712	Green floral bud	0.877
	SRR3591713	Yellow flower	0.669
SRP173429	SRR8316895	Juvenile bud stage	1.175
	SRR8316896	Juvenile bud stage	1.556
	SRR8316897	Juvenile bud stage	0.299
	SRR8316894	Third green stage	0.993
	SRR8316900	Third green stage	1.897
	SRR8316901	Third green stage	1.166
	SRR8316898	Complete white stage	0.602
	SRR8316899	Complete white stage	2.011
	SRR8316903	Complete white stage	0.449
	SRR8316902	Silver flowering stage	1.088
	SRR8316904	Silver flowering stage	1.126
	SRR8316905	Silver flowering stage	0.601
	SRR8316906	Gold flowering stage	1.102
	SRR8316907	Gold flowering stage	3.351
	SRR8316908	Gold flowering stage	1.569
SRP132670	SRR6706286	Control	0.452
	SRR6706287	Light intensity 50%	1.329
	SRR6706288	Light intensity 20%	1.354
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.926
	CNS0095593	Slightly white alabastrum(diploid) 2	1.692
	CNS0095594	Slightly white alabastrum(diploid) 3	1.789
	CNS0095595	Whole white alabastrum(diploid) 2	2.256
	CNS0095596	Whole white alabastrum(diploid) 3	2.463
	CNS0095597	Whole white alabastrum(diploid) 4	2.912
	CNS0095598	Silvery flower (diploied) 1	6.798
	CNS0095599	Silvery flower (diploied) 2	2.710
	CNS0095600	Silvery flower (diploied) 3	1.730
	CNS0095601	Golden flower (diploid) 1	1.608
	CNS0095602	Golden flower (diploid) 2	1.732
	CNS0095603	Golden flower (diploid) 3	1.877
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.474
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.694
	CNS0095606	Slightly white alabastrum(tetraploid) 3	1.066
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.971
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.081
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.690
	CNS0095610	Silvery flower (tetraploid) 1	2.092
	CNS0095611	Silvery flower (tetraploid) 2	1.952
	CNS0095612	Silvery flower (tetraploid) 3	3.162
	CNS0095613	Golden flower (tetraploid) 1	4.071
	CNS0095614	Golden flower (tetraploid) 2	3.005
	CNS0095615	Golden flower (tetraploid) 3	1.732
CRA001975	CRR073297	Stem 1	0.433
	CRR073298	Stem 2	0.429
	CRR073299	Stem 3	0.671
	CRR073300	Leaf 1	1.092
	CRR073301	Leaf 2	0.942
	CRR073302	Leaf 3	0.261
	CRR073303	Juvenile bud 1	0.195
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.113
	CRR073306	Third green 1	0.558
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.100
	CRR073309	Second white 1	0.058
	CRR073310	Second white 2	0.327
	CRR073311	Second white 3	1.040
	CRR073312	Silver flowering 1	0.231
	CRR073313	Silver flowering 2	0.054
	CRR073314	Silver flowering 3	0.133
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.088
	CRR073318	Tawny withering 1	0.204
	CRR073319	Tawny withering 2	0.855
	CRR073320	Tawny withering 3	0.050