Gene detail

Detail information of GWHGAAZE010621

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002274758.1	3.01378E-61	PREDICTED: endochitinase PR4 [Vitis vinifera]
Swissprot	tr\|P27054\|CHI4_PHAVU	5E-48	Endochitinase PR4 (Precursor)
trEMBL	tr\|F6HAW1\|F6HAW1_VITVI	1E-61	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB49365.1}
TAIR10	AT3G54420.1	1E-46	homolog of carrot EP3-3 chitinase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	15758279	15758719	-
GWHAAZE00000003	mRNA	15758279	15758719	-
GWHAAZE00000003	exon	15758279	15758719	-
GWHAAZE00000003	CDS	15758279	15758719	-

Transcript Sequence
>GWHTAAZE010633 ATGTCACCTATCACCATGAGACCAAATTTCTTTGCAAAAGTTATTCTTTTGGCCGGAATTCTCGGCGTAGCCTTGCCCGATTTTATTGCAGGCCAGAACTGCAGCTGTGCCGCAGATCTATGTTGTAGTCAATACGGTTATTGTGGCACTACTAGTGATTACTGTGGCGAAGGGTGTCAGGGTGGCCCTTGCTTTGCACCACCGGCTACTAATGGTGTTTCGGTGGCAAATATTGTTACTGATGCATTCTTTAATGGGATAATTGATCAAGCGGCCGAGGATTGTGCCGGTAAGGGCTTTTACACACGGGCTGCATTTCTTGAAGCCCTTAATTTTTATTCACAATTTGGTAGAGTTGGGTCTGAGGATGACTCTAAGCGTGAGATTGCGGCTTTCTTTGGACATGTTACACACGAGACTGGACGTAAGTTTTCAATATAA

Network for GWHGAAZE010621

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00187.20	Chitin_bind_1	32	64	4.90E-09
PF00182.20	Glyco_hydro_19	78	141	2.90E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01183	E3.2.1.14	Metabolic pathways	map01100
K01183	E3.2.1.14	Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0006032	biological_process	chitin catabolic process
GO:0016998	biological_process	cell wall macromolecule catabolic process
GO:0008061	molecular_function	chitin binding
GO:0004568	molecular_function	chitinase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.049
	SRR3591709	Stem	0.719
	SRR3591710	White floral bud	0.901
	SRR3591711	White flower	1.310
	SRR3591712	Green floral bud	0.093
	SRR3591713	Yellow flower	19.026
SRP173429	SRR8316895	Juvenile bud stage	0.017
	SRR8316896	Juvenile bud stage	0.718
	SRR8316897	Juvenile bud stage	0.510
	SRR8316894	Third green stage	0.231
	SRR8316900	Third green stage	0.019
	SRR8316901	Third green stage	0.373
	SRR8316898	Complete white stage	1.229
	SRR8316899	Complete white stage	0.490
	SRR8316903	Complete white stage	1.828
	SRR8316902	Silver flowering stage	10.395
	SRR8316904	Silver flowering stage	10.199
	SRR8316905	Silver flowering stage	7.571
	SRR8316906	Gold flowering stage	91.185
	SRR8316907	Gold flowering stage	34.412
	SRR8316908	Gold flowering stage	78.454
SRP132670	SRR6706286	Control	3.652
	SRR6706287	Light intensity 50%	2.124
	SRR6706288	Light intensity 20%	0.978
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.186
	CNS0095593	Slightly white alabastrum(diploid) 2	0.327
	CNS0095594	Slightly white alabastrum(diploid) 3	0.095
	CNS0095595	Whole white alabastrum(diploid) 2	0.045
	CNS0095596	Whole white alabastrum(diploid) 3	0.551
	CNS0095597	Whole white alabastrum(diploid) 4	0.117
	CNS0095598	Silvery flower (diploied) 1	0.989
	CNS0095599	Silvery flower (diploied) 2	0.029
	CNS0095600	Silvery flower (diploied) 3	8.585
	CNS0095601	Golden flower (diploid) 1	1.176
	CNS0095602	Golden flower (diploid) 2	11.695
	CNS0095603	Golden flower (diploid) 3	12.806
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.752
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.158
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	6.837
	CNS0095611	Silvery flower (tetraploid) 2	0.919
	CNS0095612	Silvery flower (tetraploid) 3	1.989
	CNS0095613	Golden flower (tetraploid) 1	10.384
	CNS0095614	Golden flower (tetraploid) 2	18.935
	CNS0095615	Golden flower (tetraploid) 3	0.750
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.216
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.109
	CRR073306	Third green 1	0.467
	CRR073307	Third green 2	0.056
	CRR073308	Third green 3	0.557
	CRR073309	Second white 1	1.578
	CRR073310	Second white 2	4.256
	CRR073311	Second white 3	1.149
	CRR073312	Silver flowering 1	19.217
	CRR073313	Silver flowering 2	19.706
	CRR073314	Silver flowering 3	17.967
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.295
	CRR073318	Tawny withering 1	3.500
	CRR073319	Tawny withering 2	7.447
	CRR073320	Tawny withering 3	0.419