Gene detail

Detail information of GWHGAAZE010677

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO50060.1	2.9409E-112	hypothetical protein CISIN_1g019303mg [Citrus sinensis]
Swissprot	tr\|P49249\|IN22_MAIZE	2E-107	IN2-2 protein
trEMBL	tr\|A0A067E860\|A0A067E860_CITSI	1E-112	Uncharacterized protein {ECO:0000313\|EMBL:KDO50060.1}
TAIR10	AT1G60690.1	9E-86	NAD(P)-linked oxidoreductase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	18949907	18952716	+
GWHAAZE00000003	mRNA	18949907	18952716	+
GWHAAZE00000003	exon	18949907	18950128	+
GWHAAZE00000003	exon	18950911	18951111	+
GWHAAZE00000003	exon	18952519	18952716	+
GWHAAZE00000003	CDS	18949907	18950128	+
GWHAAZE00000003	CDS	18950911	18951111	+
GWHAAZE00000003	CDS	18952519	18952716	+

Transcript Sequence
>GWHTAAZE010689 AAAACGGCGGCAGCAGTGAAGAAGAGAGTAAAGTTAGGTTCAGTAGGTTTAGAGGTATCAGCTCAGGGACTCGGATGTAGGAGCATGTCACACGGCAACAGCCCTGAGAAGCCGGAAACAGACATGATAAAGCTCATTCATCACGCCATTAACAGCGGCGTTACCTTCCTCGACACCGCCGATCTTTACGGCCCTCAGACCAACGAAATCCTCATCGGAAAGGCTTTGAAGGGAGGATTTAGAGAGAAAGTTCAATTGGCTTCTAAATTTGGTATCAGTTGGAAGGATGGAGCAATGACAGTGTGTGGCGATCCGGCATATGTAAGGAGCTGCTGTGAGGCTAGCTTGAAGAGGCTCGAGATCGATTGCATTGATCTCTATTATGCACATCGCATTGATACTCGTGTTCCCATTGAAGTTACTATGGGAGAACTGAAGAAACTGGTCGAAGAAGGTAAAATAAAATACGTGGGTCTATCAGAGGCATCTGCTTCAACAATTAGAAGGGCCCACGCTGTTCATCCGATAACAGCAGTGCAAATGGAATGGTCAATGTGGTCAAGAGATTTGGAGGCTGAAATTGTTCCGACCTGCAGGCGAGGCTTCTTCCGTGCTTCTTAA

Network for GWHGAAZE010677

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0206

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00248.22	Aldo_ket_red	30	200	5.20E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.152
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.126
	SRR3591710	White floral bud	0.128
	SRR3591711	White flower	0.067
	SRR3591712	Green floral bud	0.131
	SRR3591713	Yellow flower	0.353
SRP173429	SRR8316895	Juvenile bud stage	7.692
	SRR8316896	Juvenile bud stage	12.073
	SRR8316897	Juvenile bud stage	7.410
	SRR8316894	Third green stage	5.805
	SRR8316900	Third green stage	14.210
	SRR8316901	Third green stage	17.662
	SRR8316898	Complete white stage	6.693
	SRR8316899	Complete white stage	19.194
	SRR8316903	Complete white stage	8.335
	SRR8316902	Silver flowering stage	4.289
	SRR8316904	Silver flowering stage	3.953
	SRR8316905	Silver flowering stage	2.757
	SRR8316906	Gold flowering stage	11.955
	SRR8316907	Gold flowering stage	11.541
	SRR8316908	Gold flowering stage	12.728
SRP132670	SRR6706286	Control	14.598
	SRR6706287	Light intensity 50%	14.534
	SRR6706288	Light intensity 20%	17.854
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.814
	CNS0095593	Slightly white alabastrum(diploid) 2	8.358
	CNS0095594	Slightly white alabastrum(diploid) 3	10.323
	CNS0095595	Whole white alabastrum(diploid) 2	7.810
	CNS0095596	Whole white alabastrum(diploid) 3	11.888
	CNS0095597	Whole white alabastrum(diploid) 4	6.684
	CNS0095598	Silvery flower (diploied) 1	5.909
	CNS0095599	Silvery flower (diploied) 2	7.362
	CNS0095600	Silvery flower (diploied) 3	9.504
	CNS0095601	Golden flower (diploid) 1	5.080
	CNS0095602	Golden flower (diploid) 2	7.132
	CNS0095603	Golden flower (diploid) 3	7.710
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.393
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.446
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.248
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.479
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.287
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.063
	CNS0095612	Silvery flower (tetraploid) 3	0.133
	CNS0095613	Golden flower (tetraploid) 1	0.148
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	14.578
	CRR073298	Stem 2	14.970
	CRR073299	Stem 3	15.316
	CRR073300	Leaf 1	16.391
	CRR073301	Leaf 2	23.597
	CRR073302	Leaf 3	20.940
	CRR073303	Juvenile bud 1	16.910
	CRR073304	Juvenile bud 2	15.460
	CRR073305	Juvenile bud 3	15.046
	CRR073306	Third green 1	10.199
	CRR073307	Third green 2	6.503
	CRR073308	Third green 3	9.017
	CRR073309	Second white 1	7.469
	CRR073310	Second white 2	6.998
	CRR073311	Second white 3	3.448
	CRR073312	Silver flowering 1	4.017
	CRR073313	Silver flowering 2	4.930
	CRR073314	Silver flowering 3	2.908
	CRR073315	Gold flowering 1	3.252
	CRR073316	Gold flowering 2	4.626
	CRR073317	Gold flowering 3	3.333
	CRR073318	Tawny withering 1	13.450
	CRR073319	Tawny withering 2	8.298
	CRR073320	Tawny withering 3	9.439