Gene detail

Detail information of GWHGAAZE010695

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011097310.1	9.139E-121	PREDICTED: 50S ribosomal protein L13, chloroplastic [Sesamum indicum]
Swissprot	tr\|P51292\|RK13_PORPU	4E-27	50S ribosomal protein L13, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01366}
trEMBL	tr\|A0A068V7A6\|A0A068V7A6_COFCA	4E-117	Coffea canephora DH200=94 genomic scaffold, scaffold_135 {ECO:0000313\|EMBL:CDP16670.1}
TAIR10	AT3G01790.2	3E-64	Ribosomal protein L13 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	19540411	19541976	-
GWHAAZE00000003	mRNA	19540411	19541976	-
GWHAAZE00000003	exon	19541878	19541976	-
GWHAAZE00000003	exon	19541444	19541646	-
GWHAAZE00000003	exon	19541101	19541212	-
GWHAAZE00000003	exon	19540411	19540644	-
GWHAAZE00000003	CDS	19541878	19541976	-
GWHAAZE00000003	CDS	19541444	19541646	-
GWHAAZE00000003	CDS	19541101	19541212	-
GWHAAZE00000003	CDS	19540411	19540644	-

Transcript Sequence
>GWHTAAZE010707 ATGACATATATCTCAATTTTGATGCAGAAAGCACTTGCTGGCCTTAGACGCATTAATTTGGATGGTTTGCGGTGGAGAGTATTTGATGCCAAAGGGCAGGTCCTTGGGAGGTTGGCATCACAGATATCTACTGTAATTCAAGGCAAAGATAAGCCTACATACACGCCGAATCGTGACGAGGGGGATATGTGCATTGTGCTTAATGCAAAGGATGTTTGTGTCACTGGGAGAAAACTTACTGACAAGTTTTATCGATGGCATACAGGGCAAGTACTATTATCTTTAATCCCTACTTCTTGCAAGTATATAGGCCACCTTAAGGAGAGAAGTTTGAAAGACCAGATGGCTAAGGATCCTACTGAAGTAATTCGCAAAGCTGTCCTCCGCATGCTTCCAAGAAATAAACTTCGTGATGATAGAGATCGCAAATTGAGGATATTTGCTGGCGGGGAGCACCCATTTGGGGACAGACCCGTTGAAACCTATGTTATGCCTCCTCGACAAGTACGAGAAATGCGCCCTCGTGCGAGACGAGCCATGATTCGAGCTCAACAGAAGGCTGACCAACAACAACAGGGTACTACCAATACAAGAAAAGGCAAAAAAAGAAGAGGCGAAAGCAGAACTAGTGAGCGCATGAAAATTTGA

Network for GWHGAAZE010695

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0188

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00572.19	Ribosomal_L13	24	153	1.00E-37

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02871	RP-L13, MRPL13, rplM	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	35.170
	SRR3591706	second leaf	20.598
	SRR3591707	mature leaf	24.077
	SRR3591708	Shoot apex	45.580
	SRR3591709	Stem	36.049
	SRR3591710	White floral bud	28.049
	SRR3591711	White flower	33.331
	SRR3591712	Green floral bud	39.180
	SRR3591713	Yellow flower	32.898
SRP173429	SRR8316895	Juvenile bud stage	24.409
	SRR8316896	Juvenile bud stage	33.566
	SRR8316897	Juvenile bud stage	13.635
	SRR8316894	Third green stage	13.027
	SRR8316900	Third green stage	47.041
	SRR8316901	Third green stage	38.779
	SRR8316898	Complete white stage	12.417
	SRR8316899	Complete white stage	54.427
	SRR8316903	Complete white stage	18.632
	SRR8316902	Silver flowering stage	10.861
	SRR8316904	Silver flowering stage	12.469
	SRR8316905	Silver flowering stage	8.007
	SRR8316906	Gold flowering stage	27.003
	SRR8316907	Gold flowering stage	20.756
	SRR8316908	Gold flowering stage	21.188
SRP132670	SRR6706286	Control	56.268
	SRR6706287	Light intensity 50%	59.128
	SRR6706288	Light intensity 20%	65.196
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	44.053
	CNS0095593	Slightly white alabastrum(diploid) 2	47.054
	CNS0095594	Slightly white alabastrum(diploid) 3	40.409
	CNS0095595	Whole white alabastrum(diploid) 2	35.633
	CNS0095596	Whole white alabastrum(diploid) 3	38.723
	CNS0095597	Whole white alabastrum(diploid) 4	32.719
	CNS0095598	Silvery flower (diploied) 1	35.113
	CNS0095599	Silvery flower (diploied) 2	35.392
	CNS0095600	Silvery flower (diploied) 3	29.430
	CNS0095601	Golden flower (diploid) 1	35.485
	CNS0095602	Golden flower (diploid) 2	26.021
	CNS0095603	Golden flower (diploid) 3	27.729
	CNS0095604	Slightly white alabastrum(tetraploid) 1	37.045
	CNS0095605	Slightly white alabastrum(tetraploid) 2	41.602
	CNS0095606	Slightly white alabastrum(tetraploid) 3	53.209
	CNS0095607	Whole white alabastrum(tetraploid) 1	27.827
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.367
	CNS0095609	Whole white alabastrum(tetraploid) 3	42.634
	CNS0095610	Silvery flower (tetraploid) 1	39.328
	CNS0095611	Silvery flower (tetraploid) 2	37.686
	CNS0095612	Silvery flower (tetraploid) 3	22.702
	CNS0095613	Golden flower (tetraploid) 1	23.216
	CNS0095614	Golden flower (tetraploid) 2	34.427
	CNS0095615	Golden flower (tetraploid) 3	14.950
CRA001975	CRR073297	Stem 1	36.067
	CRR073298	Stem 2	32.921
	CRR073299	Stem 3	42.621
	CRR073300	Leaf 1	35.362
	CRR073301	Leaf 2	35.924
	CRR073302	Leaf 3	34.191
	CRR073303	Juvenile bud 1	51.382
	CRR073304	Juvenile bud 2	28.507
	CRR073305	Juvenile bud 3	32.942
	CRR073306	Third green 1	4.958
	CRR073307	Third green 2	3.995
	CRR073308	Third green 3	4.589
	CRR073309	Second white 1	6.764
	CRR073310	Second white 2	3.687
	CRR073311	Second white 3	5.028
	CRR073312	Silver flowering 1	3.010
	CRR073313	Silver flowering 2	2.532
	CRR073314	Silver flowering 3	2.801
	CRR073315	Gold flowering 1	27.677
	CRR073316	Gold flowering 2	27.171
	CRR073317	Gold flowering 3	20.551
	CRR073318	Tawny withering 1	26.002
	CRR073319	Tawny withering 2	27.622
	CRR073320	Tawny withering 3	28.733