Gene detail

Detail information of GWHGAAZE010764

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010088180.1	1.90338E-70	Dihydroneopterin aldolase [Morus notabilis]
Swissprot	tr\|Q9SF23\|FOLB1_ARATH	9E-51	Dihydroneopterin aldolase 1 {ECO:0000305}
trEMBL	tr\|W9QPY2\|W9QPY2_9ROSA	7E-71	Dihydroneopterin aldolase {ECO:0000313\|EMBL:EXB32320.1}
TAIR10	AT3G11750.1	1E-40	Dihydroneopterin aldolase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	24037832	24038670	+
GWHAAZE00000003	mRNA	24037832	24038670	+
GWHAAZE00000003	exon	24037832	24038028	+
GWHAAZE00000003	exon	24038463	24038670	+
GWHAAZE00000003	CDS	24037832	24038028	+
GWHAAZE00000003	CDS	24038463	24038670	+

Transcript Sequence
>GWHTAAZE010776 ATGGGTGATGATGGGATGATGAAGGGAGACAGACTTATACTGAGGGGACTAATGTTCCACGGTTTTCACGGTGTGAAGCCAGAAGAAAGGAAGTTGGGGCAGAAGTTCTTGATAGATGTTGACGCCTGGATGGATCTCCGTCCAGCTGGTAAATCTGACGACTTGTCCGATACTGTCAGTTATACTGATATCTACCGCATTGCTAGAGACGTTGTAGAAGGACAGCCTCAAAATCTTCTGGAGTCAGTTGCTGAACTCATTACATCTACAACTCTAACCAAATTCCCGTGTATAATGGCTGTGCGTGTGAAGGTTGGGAAGCCTCATGTCGCTGTTCTTGGTCCTGTCGATTACTTGGGAGTCGAGATTGTCAGATACAGAAACGTCGGTGGTGCGCCAGTTTAA

Network for GWHGAAZE010764

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02152.19	FolB	13	123	4.30E-32

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01633	folB	Metabolic pathways	map01100
K01633	folB	Folate biosynthesis	map00790

Gene Ontology

GO term	Ontology	Name
GO:0006760	biological_process	folic acid-containing compound metabolic process
GO:0004150	molecular_function	dihydroneopterin aldolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	11.758
	SRR3591706	second leaf	16.631
	SRR3591707	mature leaf	15.032
	SRR3591708	Shoot apex	10.919
	SRR3591709	Stem	33.295
	SRR3591710	White floral bud	5.871
	SRR3591711	White flower	5.098
	SRR3591712	Green floral bud	7.129
	SRR3591713	Yellow flower	3.556
SRP173429	SRR8316895	Juvenile bud stage	13.839
	SRR8316896	Juvenile bud stage	21.101
	SRR8316897	Juvenile bud stage	16.406
	SRR8316894	Third green stage	11.673
	SRR8316900	Third green stage	40.062
	SRR8316901	Third green stage	35.256
	SRR8316898	Complete white stage	15.811
	SRR8316899	Complete white stage	43.719
	SRR8316903	Complete white stage	24.346
	SRR8316902	Silver flowering stage	22.552
	SRR8316904	Silver flowering stage	26.421
	SRR8316905	Silver flowering stage	13.955
	SRR8316906	Gold flowering stage	37.245
	SRR8316907	Gold flowering stage	37.604
	SRR8316908	Gold flowering stage	35.044
SRP132670	SRR6706286	Control	22.339
	SRR6706287	Light intensity 50%	22.020
	SRR6706288	Light intensity 20%	26.886
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.550
	CNS0095593	Slightly white alabastrum(diploid) 2	37.609
	CNS0095594	Slightly white alabastrum(diploid) 3	31.735
	CNS0095595	Whole white alabastrum(diploid) 2	30.179
	CNS0095596	Whole white alabastrum(diploid) 3	43.498
	CNS0095597	Whole white alabastrum(diploid) 4	35.742
	CNS0095598	Silvery flower (diploied) 1	22.650
	CNS0095599	Silvery flower (diploied) 2	21.369
	CNS0095600	Silvery flower (diploied) 3	32.225
	CNS0095601	Golden flower (diploid) 1	28.758
	CNS0095602	Golden flower (diploid) 2	31.311
	CNS0095603	Golden flower (diploid) 3	34.909
	CNS0095604	Slightly white alabastrum(tetraploid) 1	25.435
	CNS0095605	Slightly white alabastrum(tetraploid) 2	27.976
	CNS0095606	Slightly white alabastrum(tetraploid) 3	32.261
	CNS0095607	Whole white alabastrum(tetraploid) 1	23.210
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.899
	CNS0095609	Whole white alabastrum(tetraploid) 3	28.345
	CNS0095610	Silvery flower (tetraploid) 1	21.981
	CNS0095611	Silvery flower (tetraploid) 2	29.776
	CNS0095612	Silvery flower (tetraploid) 3	25.937
	CNS0095613	Golden flower (tetraploid) 1	21.735
	CNS0095614	Golden flower (tetraploid) 2	23.081
	CNS0095615	Golden flower (tetraploid) 3	22.202
CRA001975	CRR073297	Stem 1	29.805
	CRR073298	Stem 2	26.304
	CRR073299	Stem 3	31.726
	CRR073300	Leaf 1	43.131
	CRR073301	Leaf 2	42.902
	CRR073302	Leaf 3	46.867
	CRR073303	Juvenile bud 1	52.851
	CRR073304	Juvenile bud 2	59.202
	CRR073305	Juvenile bud 3	54.229
	CRR073306	Third green 1	46.434
	CRR073307	Third green 2	40.284
	CRR073308	Third green 3	35.371
	CRR073309	Second white 1	30.544
	CRR073310	Second white 2	26.793
	CRR073311	Second white 3	21.368
	CRR073312	Silver flowering 1	25.508
	CRR073313	Silver flowering 2	21.261
	CRR073314	Silver flowering 3	13.394
	CRR073315	Gold flowering 1	7.159
	CRR073316	Gold flowering 2	15.583
	CRR073317	Gold flowering 3	12.603
	CRR073318	Tawny withering 1	26.817
	CRR073319	Tawny withering 2	28.799
	CRR073320	Tawny withering 3	35.625