Gene detail

Detail information of GWHGAAZE010974

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004172427.1	2.2025E-34	PREDICTED: uncharacterized protein LOC101232479 [Cucumis sativus]
trEMBL	tr\|A0A067L028\|A0A067L028_JATCU	3E-33	Uncharacterized protein {ECO:0000313\|EMBL:KDP40593.1}
TAIR10	AT5G07900.1	4E-10	Mitochondrial transcription termination factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	37415089	37415562	-
GWHAAZE00000003	mRNA	37415089	37415562	-
GWHAAZE00000003	exon	37415089	37415562	-
GWHAAZE00000003	CDS	37415089	37415562	-

Transcript Sequence
>GWHTAAZE010986 ATGAAGGTGAATAATAATCTTAAGCCTAAATTAGAGTACCTCAGGGATAATGGGCTTGAGGGTCGGCTCCTCCCGGACCTAATTGTATCAAATCCCGAAATTTTGACTAGAAGCTTGAGTGGATTTACAAAACCAAGATTGGAATTCCTTAAGAAATATTTACACACCAATGACAAAGTTTTCGGTGCTGTTAAACGTACTTCTTGGCTTTGGAGATTTAATTTGAAGGGAATTATGGAGCGGAATATTGAGTTGTTGTTAAGTGAAGGGGTGACTTCTAGAAATATAGAGAGATTGGTTTTCTGGCAGCCGAGAATTTTGATGCACAGGGTTGATAGAATTGTCTATGCGATTCGGACTGTCAAAGAGTTGGGGCTCGACCTAGTTCTTGTACATGTGTACAAGCTATTCATGTGTTGCTCTCAATCAGCCATTCAACATGGAATCAGAAAGTGCAAAATTTTAAGACTTTAG

Network for GWHGAAZE010974

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02536.15	mTERF	2	127	8.40E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	mTERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003690	molecular_function	double-stranded DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.725
	SRR3591706	second leaf	0.074
	SRR3591707	mature leaf	1.121
	SRR3591708	Shoot apex	0.263
	SRR3591709	Stem	0.678
	SRR3591710	White floral bud	0.572
	SRR3591711	White flower	0.320
	SRR3591712	Green floral bud	0.755
	SRR3591713	Yellow flower	0.460
SRP173429	SRR8316895	Juvenile bud stage	0.166
	SRR8316896	Juvenile bud stage	0.434
	SRR8316897	Juvenile bud stage	0.033
	SRR8316894	Third green stage	0.154
	SRR8316900	Third green stage	1.393
	SRR8316901	Third green stage	0.428
	SRR8316898	Complete white stage	0.878
	SRR8316899	Complete white stage	1.887
	SRR8316903	Complete white stage	0.862
	SRR8316902	Silver flowering stage	1.231
	SRR8316904	Silver flowering stage	0.631
	SRR8316905	Silver flowering stage	0.041
	SRR8316906	Gold flowering stage	0.569
	SRR8316907	Gold flowering stage	0.482
	SRR8316908	Gold flowering stage	1.983
SRP132670	SRR6706286	Control	1.292
	SRR6706287	Light intensity 50%	0.630
	SRR6706288	Light intensity 20%	0.460
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.852
	CNS0095593	Slightly white alabastrum(diploid) 2	0.088
	CNS0095594	Slightly white alabastrum(diploid) 3	0.803
	CNS0095595	Whole white alabastrum(diploid) 2	0.296
	CNS0095596	Whole white alabastrum(diploid) 3	0.067
	CNS0095597	Whole white alabastrum(diploid) 4	0.162
	CNS0095598	Silvery flower (diploied) 1	0.174
	CNS0095599	Silvery flower (diploied) 2	0.755
	CNS0095600	Silvery flower (diploied) 3	1.102
	CNS0095601	Golden flower (diploid) 1	0.647
	CNS0095602	Golden flower (diploid) 2	0.549
	CNS0095603	Golden flower (diploid) 3	0.784
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.362
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.048
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.645
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.395
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.687
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.475
	CNS0095610	Silvery flower (tetraploid) 1	0.409
	CNS0095611	Silvery flower (tetraploid) 2	0.575
	CNS0095612	Silvery flower (tetraploid) 3	0.225
	CNS0095613	Golden flower (tetraploid) 1	0.342
	CNS0095614	Golden flower (tetraploid) 2	0.322
	CNS0095615	Golden flower (tetraploid) 3	0.579
CRA001975	CRR073297	Stem 1	0.379
	CRR073298	Stem 2	0.323
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.383
	CRR073301	Leaf 2	0.229
	CRR073302	Leaf 3	0.170
	CRR073303	Juvenile bud 1	0.116
	CRR073304	Juvenile bud 2	0.086
	CRR073305	Juvenile bud 3	0.410
	CRR073306	Third green 1	0.045
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.340
	CRR073309	Second white 1	0.251
	CRR073310	Second white 2	0.083
	CRR073311	Second white 3	0.202
	CRR073312	Silver flowering 1	0.226
	CRR073313	Silver flowering 2	0.851
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.386
	CRR073316	Gold flowering 2	0.008
	CRR073317	Gold flowering 3	0.115
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.046
	CRR073320	Tawny withering 3	0.000