Gene detail

Detail information of GWHGAAZE011032

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010043906.1	1.87908E-50	PREDICTED: D-galacturonate reductase-like [Eucalyptus grandis]
Swissprot	tr\|O49133\|GALUR_FRAAN	6E-41	D-galacturonate reductase
trEMBL	tr\|A0A059D6B8\|A0A059D6B8_EUCGR	7E-51	Uncharacterized protein {ECO:0000313\|EMBL:KCW85926.1}
TAIR10	AT1G59950.1	8E-22	NAD(P)-linked oxidoreductase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	39693728	39694045	+
GWHAAZE00000003	mRNA	39693728	39694045	+
GWHAAZE00000003	exon	39693728	39694045	+
GWHAAZE00000003	CDS	39693728	39694045	+

Transcript Sequence
>GWHTAAZE011044 ATGACAAGGATACCAGAGGTAACAGTGGGTACATGCGAGAAGGCCATGCCGGTGATCGGAATGGGTACGAGCTCGGATCCTCCGGCGGATCTGGAAACCACAGTAGGGGCGCTTCTGGAAGCCATAAAAACAGGGTACCGCCACTTCGACACCGCCTTCGCCTACGGATCAGAGAAGCCACTGGGAATAGCCATAGCTAAAGCTCTGGAGCTAGGCCTAATTAAATCACGTGATGAACTCTTCATCACCACCAAGCTGTTTGCTTGCTTTGCGGAGAGGGATCAAGTTGTTCCTGCTATTAAAATGAGCCTCCAGTAA

Network for GWHGAAZE011032

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00248.22	Aldo_ket_red	19	86	6.30E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19642	GALUR	Ascorbate and aldarate metabolism	map00053

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.557
	SRR3591706	second leaf	3.964
	SRR3591707	mature leaf	3.977
	SRR3591708	Shoot apex	6.215
	SRR3591709	Stem	6.152
	SRR3591710	White floral bud	15.379
	SRR3591711	White flower	15.236
	SRR3591712	Green floral bud	11.484
	SRR3591713	Yellow flower	23.319
SRP173429	SRR8316895	Juvenile bud stage	6.536
	SRR8316896	Juvenile bud stage	7.882
	SRR8316897	Juvenile bud stage	6.682
	SRR8316894	Third green stage	3.619
	SRR8316900	Third green stage	6.399
	SRR8316901	Third green stage	6.889
	SRR8316898	Complete white stage	3.437
	SRR8316899	Complete white stage	11.067
	SRR8316903	Complete white stage	3.333
	SRR8316902	Silver flowering stage	3.497
	SRR8316904	Silver flowering stage	4.736
	SRR8316905	Silver flowering stage	2.413
	SRR8316906	Gold flowering stage	23.444
	SRR8316907	Gold flowering stage	12.605
	SRR8316908	Gold flowering stage	53.649
SRP132670	SRR6706286	Control	11.973
	SRR6706287	Light intensity 50%	11.945
	SRR6706288	Light intensity 20%	7.114
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	15.969
	CNS0095593	Slightly white alabastrum(diploid) 2	21.630
	CNS0095594	Slightly white alabastrum(diploid) 3	12.724
	CNS0095595	Whole white alabastrum(diploid) 2	12.328
	CNS0095596	Whole white alabastrum(diploid) 3	7.457
	CNS0095597	Whole white alabastrum(diploid) 4	9.711
	CNS0095598	Silvery flower (diploied) 1	4.308
	CNS0095599	Silvery flower (diploied) 2	3.677
	CNS0095600	Silvery flower (diploied) 3	7.280
	CNS0095601	Golden flower (diploid) 1	5.615
	CNS0095602	Golden flower (diploid) 2	5.053
	CNS0095603	Golden flower (diploid) 3	3.881
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.899
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.202
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.747
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.773
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.941
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.470
	CNS0095610	Silvery flower (tetraploid) 1	35.121
	CNS0095611	Silvery flower (tetraploid) 2	22.934
	CNS0095612	Silvery flower (tetraploid) 3	18.022
	CNS0095613	Golden flower (tetraploid) 1	28.084
	CNS0095614	Golden flower (tetraploid) 2	38.736
	CNS0095615	Golden flower (tetraploid) 3	4.382
CRA001975	CRR073297	Stem 1	5.120
	CRR073298	Stem 2	4.754
	CRR073299	Stem 3	2.377
	CRR073300	Leaf 1	7.700
	CRR073301	Leaf 2	7.408
	CRR073302	Leaf 3	3.618
	CRR073303	Juvenile bud 1	3.652
	CRR073304	Juvenile bud 2	2.886
	CRR073305	Juvenile bud 3	3.690
	CRR073306	Third green 1	2.130
	CRR073307	Third green 2	2.006
	CRR073308	Third green 3	0.671
	CRR073309	Second white 1	1.204
	CRR073310	Second white 2	1.752
	CRR073311	Second white 3	3.427
	CRR073312	Silver flowering 1	2.759
	CRR073313	Silver flowering 2	3.736
	CRR073314	Silver flowering 3	2.892
	CRR073315	Gold flowering 1	7.154
	CRR073316	Gold flowering 2	5.200
	CRR073317	Gold flowering 3	5.857
	CRR073318	Tawny withering 1	38.019
	CRR073319	Tawny withering 2	40.843
	CRR073320	Tawny withering 3	3.021