Gene detail

Detail information of GWHGAAZE011090

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006357043.1	2.0156E-50	PREDICTED: copper transporter 6-like [Solanum tuberosum]
Swissprot	tr\|Q8GWP3\|COPT6_ARATH	6E-42	Copper transporter 6
trEMBL	tr\|M1AKG7\|M1AKG7_SOLTU	8E-51	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400024665}
TAIR10	AT5G59030.1	9E-30	copper transporter 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	42140816	42144891	+
GWHAAZE00000003	mRNA	42140816	42144891	+
GWHAAZE00000003	exon	42140816	42141058	+
GWHAAZE00000003	exon	42144670	42144891	+
GWHAAZE00000003	CDS	42140816	42141058	+
GWHAAZE00000003	CDS	42144670	42144891	+

Transcript Sequence
>GWHTAAZE011102 ATGGACGCCACGTCCATGCCTGGTATGCAAGACAACATGACAATGGCCGGGATGCACAACCACACCACGGCGATGATGGGGATGACGATGCACACCGCCTTCTATTGGGGCAATGACGCGGAGTTTCTCTTCTCCGGTTGGCCCGGAACCAACAAATCTGGGATGTACGTGCTATCGCTTATCCTCATCTTCGCCCTCGCTTTTATAGTCGAGTGGCTCTCTCACAGCACTTTCATCAAACAGGTGGTGAGCGACGTATCAGCCGGTCTACTTCAAACCCTGATGTATACTATACGCATCGGTCTTGCTTACGTGGTTATGTTGTCCGTGATGTCTATGAACGGCGGCGTATTTTTGGTGGCCGTAGGTGGGCACGCGGTGGGGTACATGTTATTTGGGAGTCGGATTTTTAGGAAGTCAGCAATTTTGGAATCCGACGATTTGCCACCATTGACTTGTTGCTAA

Network for GWHGAAZE011090

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04145.16	Ctr	34	74	3.20E-06
PF04145.16	Ctr	86	132	3.80E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14686	SLC31A1, CTR1	Mineral absorption	map04978

Gene Ontology

GO term	Ontology	Name
GO:0035434	biological_process	copper ion transmembrane transport
GO:0016021	cellular_component	integral component of membrane
GO:0005375	molecular_function	copper ion transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	7.658
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	8.018
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	54.973
	SRR3591710	White floral bud	1.392
	SRR3591711	White flower	0.607
	SRR3591712	Green floral bud	0.487
	SRR3591713	Yellow flower	19.970
SRP173429	SRR8316895	Juvenile bud stage	0.224
	SRR8316896	Juvenile bud stage	0.302
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.091
	SRR8316900	Third green stage	0.103
	SRR8316901	Third green stage	0.076
	SRR8316898	Complete white stage	0.157
	SRR8316899	Complete white stage	0.273
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.086
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.835
SRP132670	SRR6706286	Control	0.716
	SRR6706287	Light intensity 50%	0.530
	SRR6706288	Light intensity 20%	0.333
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.015
	CNS0095593	Slightly white alabastrum(diploid) 2	0.134
	CNS0095594	Slightly white alabastrum(diploid) 3	0.036
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.086
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.239
	CNS0095600	Silvery flower (diploied) 3	0.061
	CNS0095601	Golden flower (diploid) 1	1.010
	CNS0095602	Golden flower (diploid) 2	0.157
	CNS0095603	Golden flower (diploid) 3	0.257
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.044
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.097
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.110
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.203
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.300
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.360
	CNS0095610	Silvery flower (tetraploid) 1	1.283
	CNS0095611	Silvery flower (tetraploid) 2	2.565
	CNS0095612	Silvery flower (tetraploid) 3	2.283
	CNS0095613	Golden flower (tetraploid) 1	106.995
	CNS0095614	Golden flower (tetraploid) 2	19.772
	CNS0095615	Golden flower (tetraploid) 3	1.911
CRA001975	CRR073297	Stem 1	2.315
	CRR073298	Stem 2	0.334
	CRR073299	Stem 3	1.335
	CRR073300	Leaf 1	0.284
	CRR073301	Leaf 2	0.441
	CRR073302	Leaf 3	0.015
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.452
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.491
	CRR073308	Third green 3	0.150
	CRR073309	Second white 1	0.594
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.219
	CRR073314	Silver flowering 3	3.425
	CRR073315	Gold flowering 1	1.082
	CRR073316	Gold flowering 2	0.118
	CRR073317	Gold flowering 3	1.141
	CRR073318	Tawny withering 1	0.071
	CRR073319	Tawny withering 2	0.324
	CRR073320	Tawny withering 3	0.178