Gene detail

Detail information of GWHGAAZE011339

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_001773593.1	4.38722E-19	predicted protein [Physcomitrella patens]
Swissprot	tr\|O65059\|RS15_PICMA	7E-20	40S ribosomal protein S15
trEMBL	tr\|A9T4N2\|A9T4N2_PHYPA	2E-19	Predicted protein {ECO:0000313\|EMBL:EDQ61631.1}
TAIR10	AT5G09510.1	5E-16	Ribosomal protein S19 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	58039596	58040081	-
GWHAAZE00000003	mRNA	58039596	58040081	-
GWHAAZE00000003	exon	58039867	58040081	-
GWHAAZE00000003	exon	58039596	58039635	-
GWHAAZE00000003	CDS	58039867	58040081	-
GWHAAZE00000003	CDS	58039596	58039635	-

Transcript Sequence
>GWHTAAZE011351 ATGAAGAAGCTACACAAGGCAAAACGTAAGGCTTTGACTGGCAAGAAGCTAGAACTTGTGAAAATCCATCCGCTTAATATGATCGTAGTACATAAGATGATTGCAAGCGTTGTTGGAGTGTGCAATGGCAATACTTTCAATTTGAGTGAAATCAAGCATGAAATTACAGGCCATTATTTCACCAAGTTCTTGATATCGTACCAGGAGAAGATCAGTATAATAACGGTGGCTGTCATTCTCAGAAAAGGAGAATAA

Network for GWHGAAZE011339

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00203.22	Ribosomal_S19	2	68	3.50E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02958	RP-S15e, RPS15	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.932
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.327
	SRR3591709	Stem	1.672
	SRR3591710	White floral bud	0.291
	SRR3591711	White flower	0.632
	SRR3591712	Green floral bud	0.873
	SRR3591713	Yellow flower	0.211
SRP173429	SRR8316895	Juvenile bud stage	0.808
	SRR8316896	Juvenile bud stage	0.551
	SRR8316897	Juvenile bud stage	0.793
	SRR8316894	Third green stage	0.923
	SRR8316900	Third green stage	1.104
	SRR8316901	Third green stage	2.714
	SRR8316898	Complete white stage	0.225
	SRR8316899	Complete white stage	1.446
	SRR8316903	Complete white stage	0.974
	SRR8316902	Silver flowering stage	0.185
	SRR8316904	Silver flowering stage	0.759
	SRR8316905	Silver flowering stage	0.135
	SRR8316906	Gold flowering stage	0.499
	SRR8316907	Gold flowering stage	0.333
	SRR8316908	Gold flowering stage	0.034
SRP132670	SRR6706286	Control	1.259
	SRR6706287	Light intensity 50%	0.928
	SRR6706288	Light intensity 20%	1.075
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.083
	CNS0095593	Slightly white alabastrum(diploid) 2	1.198
	CNS0095594	Slightly white alabastrum(diploid) 3	2.309
	CNS0095595	Whole white alabastrum(diploid) 2	0.488
	CNS0095596	Whole white alabastrum(diploid) 3	0.629
	CNS0095597	Whole white alabastrum(diploid) 4	0.461
	CNS0095598	Silvery flower (diploied) 1	1.795
	CNS0095599	Silvery flower (diploied) 2	2.966
	CNS0095600	Silvery flower (diploied) 3	0.660
	CNS0095601	Golden flower (diploid) 1	0.507
	CNS0095602	Golden flower (diploid) 2	0.396
	CNS0095603	Golden flower (diploid) 3	1.234
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.642
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.408
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.383
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.468
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.763
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.527
	CNS0095610	Silvery flower (tetraploid) 1	1.736
	CNS0095611	Silvery flower (tetraploid) 2	2.280
	CNS0095612	Silvery flower (tetraploid) 3	1.458
	CNS0095613	Golden flower (tetraploid) 1	1.097
	CNS0095614	Golden flower (tetraploid) 2	1.093
	CNS0095615	Golden flower (tetraploid) 3	0.025
CRA001975	CRR073297	Stem 1	0.749
	CRR073298	Stem 2	0.715
	CRR073299	Stem 3	0.172
	CRR073300	Leaf 1	1.591
	CRR073301	Leaf 2	1.252
	CRR073302	Leaf 3	0.626
	CRR073303	Juvenile bud 1	1.679
	CRR073304	Juvenile bud 2	0.095
	CRR073305	Juvenile bud 3	1.070
	CRR073306	Third green 1	0.237
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.549
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	1.207
	CRR073311	Second white 3	0.455
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.069
	CRR073316	Gold flowering 2	2.744
	CRR073317	Gold flowering 3	0.934
	CRR073318	Tawny withering 1	0.062
	CRR073319	Tawny withering 2	1.622
	CRR073320	Tawny withering 3	0.165