Gene detail

Detail information of GWHGAAZE011348

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002321344.1	4.9251E-99	hypothetical protein POPTR_0015s00340g [Populus trichocarpa]
Swissprot	tr\|Q6AWV1\|POP5_ARATH	4E-70	Probable ribonuclease P/MRP protein subunit POP5
trEMBL	tr\|B9IDE0\|B9IDE0_POPTR	2E-99	Uncharacterized protein {ECO:0000313\|EMBL:EEF05471.1}
TAIR10	AT1G04635.1	9E-56	ribonuclease P family protein / Rpp14 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	58396077	58397299	+
GWHAAZE00000003	mRNA	58396077	58397299	+
GWHAAZE00000003	exon	58396077	58396257	+
GWHAAZE00000003	exon	58396354	58396491	+
GWHAAZE00000003	exon	58397151	58397299	+
GWHAAZE00000003	CDS	58396077	58396257	+
GWHAAZE00000003	CDS	58396354	58396491	+
GWHAAZE00000003	CDS	58397151	58397299	+

Transcript Sequence
>GWHTAAZE011360 ATCATGGTGGGATTTAAAAACCGATACTTGGTAATGGAAGTTTTTTTGGATCCAAATCGAGACCTTGCCACAGAGGACCCTATTATAGTTACCCAATTTAATGTGTCAAAAGCAGTCAAAGAAAGCATTCTTGTGAACTTTGGTGAGTGTGGTCTTGCTTCATCAGTCAGCTCATTCCAAGTGAAGTACGTGAATCCCATTACAAAACTGTGCATTATCAGAACCTCGAGGGAGGAGTACCAAAAAGTTTGGTCAGCAATTACCATGGTCAGGAGCATCGGAAATTGCCCGGTGATGTTCAACTTACTGGACCTGAGTGGAAGTGTCAAGGCTTGTAGAACTGCAGCTTTAAAGTGTGATGAATTAAAATTTGAGCACTACAAGCTTGTCGCTGGGACACGCCTCACAGCTGATGTCAACCAGCACATGCAGAACTGCCTTGAGAAGATCAAAATTTTAGAGCACTGA

Network for GWHGAAZE011348

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01900.20	RNase_P_Rpp14	8	116	3.50E-27

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03537	POP5	RNA transport	map03013
K03537	POP5	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0008033	biological_process	tRNA processing
GO:0004540	molecular_function	ribonuclease activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	13.331
	SRR3591706	second leaf	9.994
	SRR3591707	mature leaf	9.466
	SRR3591708	Shoot apex	17.006
	SRR3591709	Stem	11.904
	SRR3591710	White floral bud	9.732
	SRR3591711	White flower	10.590
	SRR3591712	Green floral bud	9.620
	SRR3591713	Yellow flower	13.058
SRP173429	SRR8316895	Juvenile bud stage	10.363
	SRR8316896	Juvenile bud stage	13.498
	SRR8316897	Juvenile bud stage	5.086
	SRR8316894	Third green stage	5.805
	SRR8316900	Third green stage	15.213
	SRR8316901	Third green stage	12.334
	SRR8316898	Complete white stage	5.432
	SRR8316899	Complete white stage	22.860
	SRR8316903	Complete white stage	9.356
	SRR8316902	Silver flowering stage	7.824
	SRR8316904	Silver flowering stage	10.539
	SRR8316905	Silver flowering stage	5.225
	SRR8316906	Gold flowering stage	16.742
	SRR8316907	Gold flowering stage	13.162
	SRR8316908	Gold flowering stage	11.010
SRP132670	SRR6706286	Control	8.579
	SRR6706287	Light intensity 50%	8.018
	SRR6706288	Light intensity 20%	10.378
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.570
	CNS0095593	Slightly white alabastrum(diploid) 2	12.655
	CNS0095594	Slightly white alabastrum(diploid) 3	11.178
	CNS0095595	Whole white alabastrum(diploid) 2	8.829
	CNS0095596	Whole white alabastrum(diploid) 3	8.975
	CNS0095597	Whole white alabastrum(diploid) 4	9.809
	CNS0095598	Silvery flower (diploied) 1	8.245
	CNS0095599	Silvery flower (diploied) 2	9.117
	CNS0095600	Silvery flower (diploied) 3	17.761
	CNS0095601	Golden flower (diploid) 1	9.557
	CNS0095602	Golden flower (diploid) 2	11.309
	CNS0095603	Golden flower (diploid) 3	14.868
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.282
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.437
	CNS0095606	Slightly white alabastrum(tetraploid) 3	12.771
	CNS0095607	Whole white alabastrum(tetraploid) 1	6.076
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.794
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.470
	CNS0095610	Silvery flower (tetraploid) 1	14.361
	CNS0095611	Silvery flower (tetraploid) 2	13.864
	CNS0095612	Silvery flower (tetraploid) 3	12.000
	CNS0095613	Golden flower (tetraploid) 1	10.492
	CNS0095614	Golden flower (tetraploid) 2	11.741
	CNS0095615	Golden flower (tetraploid) 3	11.140
CRA001975	CRR073297	Stem 1	10.495
	CRR073298	Stem 2	9.534
	CRR073299	Stem 3	13.368
	CRR073300	Leaf 1	10.441
	CRR073301	Leaf 2	10.707
	CRR073302	Leaf 3	13.008
	CRR073303	Juvenile bud 1	13.831
	CRR073304	Juvenile bud 2	10.832
	CRR073305	Juvenile bud 3	12.435
	CRR073306	Third green 1	6.818
	CRR073307	Third green 2	11.337
	CRR073308	Third green 3	7.967
	CRR073309	Second white 1	9.147
	CRR073310	Second white 2	11.963
	CRR073311	Second white 3	5.482
	CRR073312	Silver flowering 1	11.010
	CRR073313	Silver flowering 2	10.416
	CRR073314	Silver flowering 3	5.835
	CRR073315	Gold flowering 1	9.170
	CRR073316	Gold flowering 2	15.813
	CRR073317	Gold flowering 3	13.338
	CRR073318	Tawny withering 1	10.955
	CRR073319	Tawny withering 2	17.985
	CRR073320	Tawny withering 3	13.936