Gene detail

Detail information of GWHGAAZE011356

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009343156.1	2.83992E-16	PREDICTED: protein kinase APK1B, chloroplastic-like [Pyrus x bretschneideri]
Swissprot	tr\|Q8H186\|Y3545_ARATH	5E-11	Probable receptor-like protein kinase At3g55450
trEMBL	tr\|W9QW66\|W9QW66_9ROSA	4E-16	Serine/threonine-protein kinase BIK1 {ECO:0000313\|EMBL:EXB40298.1}
TAIR10	AT3G55450.1	6E-10	PBS1-like 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	58546164	58547662	+
GWHAAZE00000003	mRNA	58546164	58547662	+
GWHAAZE00000003	exon	58546164	58546301	+
GWHAAZE00000003	exon	58546404	58546527	+
GWHAAZE00000003	exon	58547237	58547305	+
GWHAAZE00000003	exon	58547502	58547662	+
GWHAAZE00000003	CDS	58546164	58546301	+
GWHAAZE00000003	CDS	58546404	58546527	+
GWHAAZE00000003	CDS	58547237	58547305	+
GWHAAZE00000003	CDS	58547502	58547662	+

Transcript Sequence
>GWHTAAZE011368 ATGTACATAGACAACTTTTCTTGGATCCAGAGGATTAAAGTTGCCCTTGAATTTGCCAAGCTCCTTGAATTTCTGCATGAGGGCGAATATCCATTTATGGTCTTCAATATCGATTCAGCAAATATTATGCTTGATCAGGCATGCAATCCAGTACTGATAGACTTTGGGTTGCTTAGTGGTGGGATGATGGGTGGACAACGTTTTTCACAGGGGTTTCAACACATGTCAGTAGGTTACTGTGACACATATTATCTTAGGACAGAGGACAATGGCTCCATGTATCTCATGTACGAGTACATGAAAAGAACACCAGTGATCAAGAATTTTGAAGGACAAGATGCCAAATTGCGCACAAGGGGCATTACCTACGAATCTTCCTCTCAGCAATCTAACGAAGACTACAACAGAATCAATCACGAAACCAGAAAAGGACACACCCCAAGGAGAGATCTTCGGGAGGAGTTCAACCAAAGATGGCATGAGATGTCGTAA

Network for GWHGAAZE011356

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0071

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.573
	SRR3591706	second leaf	1.617
	SRR3591707	mature leaf	0.977
	SRR3591708	Shoot apex	1.061
	SRR3591709	Stem	1.086
	SRR3591710	White floral bud	3.865
	SRR3591711	White flower	2.999
	SRR3591712	Green floral bud	4.398
	SRR3591713	Yellow flower	2.979
SRP173429	SRR8316895	Juvenile bud stage	4.632
	SRR8316896	Juvenile bud stage	6.524
	SRR8316897	Juvenile bud stage	2.790
	SRR8316894	Third green stage	2.925
	SRR8316900	Third green stage	5.647
	SRR8316901	Third green stage	5.506
	SRR8316898	Complete white stage	1.887
	SRR8316899	Complete white stage	3.977
	SRR8316903	Complete white stage	8.628
	SRR8316902	Silver flowering stage	5.233
	SRR8316904	Silver flowering stage	14.964
	SRR8316905	Silver flowering stage	4.062
	SRR8316906	Gold flowering stage	14.873
	SRR8316907	Gold flowering stage	13.503
	SRR8316908	Gold flowering stage	9.049
SRP132670	SRR6706286	Control	8.270
	SRR6706287	Light intensity 50%	7.999
	SRR6706288	Light intensity 20%	8.802
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.001
	CNS0095593	Slightly white alabastrum(diploid) 2	0.541
	CNS0095594	Slightly white alabastrum(diploid) 3	3.369
	CNS0095595	Whole white alabastrum(diploid) 2	1.592
	CNS0095596	Whole white alabastrum(diploid) 3	0.529
	CNS0095597	Whole white alabastrum(diploid) 4	1.205
	CNS0095598	Silvery flower (diploied) 1	1.384
	CNS0095599	Silvery flower (diploied) 2	0.580
	CNS0095600	Silvery flower (diploied) 3	10.310
	CNS0095601	Golden flower (diploid) 1	0.839
	CNS0095602	Golden flower (diploid) 2	8.807
	CNS0095603	Golden flower (diploid) 3	7.759
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.377
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.269
	CNS0095606	Slightly white alabastrum(tetraploid) 3	17.314
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.123
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.553
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.589
	CNS0095610	Silvery flower (tetraploid) 1	6.643
	CNS0095611	Silvery flower (tetraploid) 2	7.092
	CNS0095612	Silvery flower (tetraploid) 3	9.550
	CNS0095613	Golden flower (tetraploid) 1	3.204
	CNS0095614	Golden flower (tetraploid) 2	5.379
	CNS0095615	Golden flower (tetraploid) 3	8.644
CRA001975	CRR073297	Stem 1	4.370
	CRR073298	Stem 2	4.022
	CRR073299	Stem 3	0.681
	CRR073300	Leaf 1	3.409
	CRR073301	Leaf 2	2.129
	CRR073302	Leaf 3	0.206
	CRR073303	Juvenile bud 1	0.808
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.580
	CRR073306	Third green 1	0.269
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.109
	CRR073309	Second white 1	0.276
	CRR073310	Second white 2	0.488
	CRR073311	Second white 3	0.251
	CRR073312	Silver flowering 1	0.452
	CRR073313	Silver flowering 2	0.340
	CRR073314	Silver flowering 3	0.109
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.014
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.535
	CRR073319	Tawny withering 2	0.493
	CRR073320	Tawny withering 3	0.131