Gene detail

Detail information of GWHGAAZE011477

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011041493.1	2.0849E-111	PREDICTED: probable glutathione S-transferase isoform X2 [Populus euphratica]
Swissprot	tr\|Q9FQA3\|GST23_MAIZE	2E-68	Glutathione transferase GST 23
trEMBL	tr\|A0A061ET20\|A0A061ET20_THECC	7E-111	Glutathione S-transferase tau 7 {ECO:0000313\|EMBL:EOY05459.1}
TAIR10	AT2G29420.1	4E-43	glutathione S-transferase tau 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	62915659	62918661	+
GWHAAZE00000003	mRNA	62915659	62918661	+
GWHAAZE00000003	exon	62915659	62915967	+
GWHAAZE00000003	exon	62918275	62918661	+
GWHAAZE00000003	CDS	62915659	62915967	+
GWHAAZE00000003	CDS	62918275	62918661	+

Transcript Sequence
>GWHTAAZE011489 ATGGAAGAAGTGAAATTACATGGATTTTGGGCAAGCCCTTTTAGCCATAGAGTAATATGGTCTTTGAAACTAAAGGGTGTGAATTATGACTACATAGAAGAAGATCTCTCTAACAAGAGCCAGGCTTTGCTACAGTACAATCCGGTGCACAAGAAGATCCCTGTGCTCGTCCATGGCGGAAAACCGATCGCCGAGTCCTCTGTTATCCTTGAATATATTGAAGAAGTATGGCCGGAGAATCCGTTGCTGCCTAAAGATGCATATGAGAGAGCCATGGCTAGGTTTTGGATTAAATTTGTAGAAGAAAAGGGGCTCACATTCTATGGATTCTACAAAAGTACCCCAGGAGAGGAGCAAGAAAAGGCAACAAAAGAAATTATGGAAATTCTAAAAATCCTTGAAGAAAAAGCACTTGGGGATAAAAAGTTCTTTGGTGGTGACAAATTAGGGTTAGTGGACATATCATTTGGATGGCTTGCTCATTGGTTTCAATTCACACAAAAATTAGTGGGCATACAAGTTATTGAACCAGCCACTCTACCCAAATTACATGCTTGGATCAACAATTTTAAACAAATTCCACTCATTAAAGAGAATTTGCCTGATGGTGAAAAATTGTTGGTCCATTTGAAGAATCTTAGGGAGTGGCTTATTGCTGAGAAAAATCTAAAAGTTAATGTGGAGTTTATGATTTGA

Network for GWHGAAZE011477

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02798.21	GST_N	3	74	6.10E-17
PF00043.26	GST_C	102	193	1.10E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00799	GST, gst	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Metabolism of xenobiotics by cytochrome P450	map00980
		Drug metabolism - cytochrome P450	map00982
		Drug metabolism - other enzymes	map00983
		Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.130
	SRR3591706	second leaf	0.080
	SRR3591707	mature leaf	4.899
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	1.087
	SRR3591710	White floral bud	0.433
	SRR3591711	White flower	0.730
	SRR3591712	Green floral bud	0.039
	SRR3591713	Yellow flower	0.115
SRP173429	SRR8316895	Juvenile bud stage	1.468
	SRR8316896	Juvenile bud stage	4.716
	SRR8316897	Juvenile bud stage	0.556
	SRR8316894	Third green stage	0.933
	SRR8316900	Third green stage	0.762
	SRR8316901	Third green stage	1.385
	SRR8316898	Complete white stage	0.738
	SRR8316899	Complete white stage	7.080
	SRR8316903	Complete white stage	0.992
	SRR8316902	Silver flowering stage	1.174
	SRR8316904	Silver flowering stage	0.121
	SRR8316905	Silver flowering stage	0.141
	SRR8316906	Gold flowering stage	1.307
	SRR8316907	Gold flowering stage	0.386
	SRR8316908	Gold flowering stage	0.723
SRP132670	SRR6706286	Control	13.170
	SRR6706287	Light intensity 50%	5.410
	SRR6706288	Light intensity 20%	3.415
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.538
	CNS0095593	Slightly white alabastrum(diploid) 2	1.252
	CNS0095594	Slightly white alabastrum(diploid) 3	3.110
	CNS0095595	Whole white alabastrum(diploid) 2	0.694
	CNS0095596	Whole white alabastrum(diploid) 3	0.306
	CNS0095597	Whole white alabastrum(diploid) 4	0.398
	CNS0095598	Silvery flower (diploied) 1	4.572
	CNS0095599	Silvery flower (diploied) 2	2.010
	CNS0095600	Silvery flower (diploied) 3	0.877
	CNS0095601	Golden flower (diploid) 1	5.968
	CNS0095602	Golden flower (diploid) 2	3.294
	CNS0095603	Golden flower (diploid) 3	2.563
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.079
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.080
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.211
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.905
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.049
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.378
	CNS0095610	Silvery flower (tetraploid) 1	0.501
	CNS0095611	Silvery flower (tetraploid) 2	0.518
	CNS0095612	Silvery flower (tetraploid) 3	0.447
	CNS0095613	Golden flower (tetraploid) 1	0.254
	CNS0095614	Golden flower (tetraploid) 2	0.474
	CNS0095615	Golden flower (tetraploid) 3	0.025
CRA001975	CRR073297	Stem 1	0.552
	CRR073298	Stem 2	1.835
	CRR073299	Stem 3	0.540
	CRR073300	Leaf 1	0.133
	CRR073301	Leaf 2	0.350
	CRR073302	Leaf 3	0.132
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.344
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.269
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	31.209
	CRR073316	Gold flowering 2	41.083
	CRR073317	Gold flowering 3	19.741
	CRR073318	Tawny withering 1	9.457
	CRR073319	Tawny withering 2	10.384
	CRR073320	Tawny withering 3	5.893