Gene detail

Detail information of GWHGAAZE011542

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP16772.1	1.30699E-48	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LNT9\|ASK4_ARATH	1E-43	SKP1-like protein 4
trEMBL	tr\|W5HTN3\|W5HTN3_WHEAT	2E-50	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Traes_7BS_47DF1B591.1}
TAIR10	AT1G20140.1	2E-35	SKP1-like 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	64936789	64937256	+
GWHAAZE00000003	mRNA	64936789	64937256	+
GWHAAZE00000003	exon	64936789	64937256	+
GWHAAZE00000003	CDS	64936789	64937256	+

Transcript Sequence
>GWHTAAZE011554 ATGTCGACGACATCGCAAGAAAAGAAATTGGTTACGTTGAAGAGCTCCGACAAACAAGAATTCGTCGTTGAAGAGTCGATCGCGGTCACATCAGAGACAATAAAGAATATCATTGAAGACGTTGGACTCGAGTTGATCCCTCTGCCCAACGTCGACGGCAAAACCCTAGCTAAGGTAATCGAGTACTGCACCAAACATTCTACTGGTTCTAATGATGATAGCGAAGATCTTAAAAAATTCGACGACGAGTTCCTCGATTCGAATCAAATACAAGTTCTATTCGATATGGTACTGGCTGCTAATTATCTCAACATTAAGAGCTTGCTAGAAAAAGTTTGTACGAAGATAGCTGATCGCATTAAAGATATGAGTGTGGAGGAGGTTCGTGAAGTATTTAAGATCGAGAACGACTTCACACCCGAGGAAGAGAAGAAGATCCGAGATGAACATGCCTGGGCTCATGAGTAA

Network for GWHGAAZE011542

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03931.16	Skp1_POZ	10	67	7.70E-21
PF01466.20	Skp1	106	153	8.70E-20

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	SKP1

KEGG pathway

KO	Enzyme	pathway	mapID
K03094	SKP1, CBF3D	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		Wnt signaling pathway	map04310
		Hedgehog signaling pathway - fly	map04341
		TGF-beta signaling pathway	map04350
		Cell cycle	map04110
		Cell cycle - yeast	map04111
		Oocyte meiosis	map04114
		Circadian rhythm	map04710

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.232
	SRR3591706	second leaf	0.352
	SRR3591707	mature leaf	0.633
	SRR3591708	Shoot apex	0.599
	SRR3591709	Stem	5.552
	SRR3591710	White floral bud	15.983
	SRR3591711	White flower	16.283
	SRR3591712	Green floral bud	12.857
	SRR3591713	Yellow flower	14.381
SRP173429	SRR8316895	Juvenile bud stage	10.576
	SRR8316896	Juvenile bud stage	16.845
	SRR8316897	Juvenile bud stage	6.912
	SRR8316894	Third green stage	5.272
	SRR8316900	Third green stage	14.280
	SRR8316901	Third green stage	12.233
	SRR8316898	Complete white stage	5.874
	SRR8316899	Complete white stage	13.165
	SRR8316903	Complete white stage	10.515
	SRR8316902	Silver flowering stage	6.468
	SRR8316904	Silver flowering stage	5.999
	SRR8316905	Silver flowering stage	3.856
	SRR8316906	Gold flowering stage	17.691
	SRR8316907	Gold flowering stage	12.020
	SRR8316908	Gold flowering stage	13.027
SRP132670	SRR6706286	Control	12.724
	SRR6706287	Light intensity 50%	10.923
	SRR6706288	Light intensity 20%	11.377
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	12.136
	CNS0095593	Slightly white alabastrum(diploid) 2	11.838
	CNS0095594	Slightly white alabastrum(diploid) 3	14.837
	CNS0095595	Whole white alabastrum(diploid) 2	10.532
	CNS0095596	Whole white alabastrum(diploid) 3	6.318
	CNS0095597	Whole white alabastrum(diploid) 4	8.348
	CNS0095598	Silvery flower (diploied) 1	13.660
	CNS0095599	Silvery flower (diploied) 2	7.397
	CNS0095600	Silvery flower (diploied) 3	15.006
	CNS0095601	Golden flower (diploid) 1	12.902
	CNS0095602	Golden flower (diploid) 2	11.502
	CNS0095603	Golden flower (diploid) 3	11.442
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.842
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.873
	CNS0095606	Slightly white alabastrum(tetraploid) 3	13.732
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.199
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.007
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.537
	CNS0095610	Silvery flower (tetraploid) 1	12.711
	CNS0095611	Silvery flower (tetraploid) 2	9.840
	CNS0095612	Silvery flower (tetraploid) 3	15.511
	CNS0095613	Golden flower (tetraploid) 1	11.275
	CNS0095614	Golden flower (tetraploid) 2	11.877
	CNS0095615	Golden flower (tetraploid) 3	14.987
CRA001975	CRR073297	Stem 1	9.738
	CRR073298	Stem 2	6.519
	CRR073299	Stem 3	8.712
	CRR073300	Leaf 1	5.276
	CRR073301	Leaf 2	7.411
	CRR073302	Leaf 3	14.409
	CRR073303	Juvenile bud 1	9.070
	CRR073304	Juvenile bud 2	6.003
	CRR073305	Juvenile bud 3	4.980
	CRR073306	Third green 1	4.416
	CRR073307	Third green 2	7.589
	CRR073308	Third green 3	2.895
	CRR073309	Second white 1	5.565
	CRR073310	Second white 2	6.443
	CRR073311	Second white 3	6.270
	CRR073312	Silver flowering 1	7.236
	CRR073313	Silver flowering 2	7.908
	CRR073314	Silver flowering 3	5.197
	CRR073315	Gold flowering 1	1.666
	CRR073316	Gold flowering 2	0.908
	CRR073317	Gold flowering 3	1.710
	CRR073318	Tawny withering 1	10.207
	CRR073319	Tawny withering 2	7.747
	CRR073320	Tawny withering 3	10.086