Gene detail

Detail information of GWHGAAZE011543

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008349016.1	1.46057E-25	PREDICTED: histone-lysine N-methyltransferase SUVR2-like [Malus domestica]
Swissprot	tr\|Q946J2\|SUVR1_ARATH	3E-20	Histone-lysine N-methyltransferase SUVR1
trEMBL	tr\|F6H8U5\|F6H8U5_VITVI	8E-25	Putative uncharacterized protein {ECO:0000313\|EMBL:CCB48620.1}
TAIR10	AT1G04050.1	3E-18	homolog of SU(var)3-9 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	64939226	64941331	+
GWHAAZE00000003	mRNA	64939226	64941331	+
GWHAAZE00000003	exon	64939226	64939374	+
GWHAAZE00000003	exon	64940413	64940479	+
GWHAAZE00000003	exon	64940749	64940799	+
GWHAAZE00000003	exon	64941254	64941331	+
GWHAAZE00000003	CDS	64939226	64939374	+
GWHAAZE00000003	CDS	64940413	64940479	+
GWHAAZE00000003	CDS	64940749	64940799	+
GWHAAZE00000003	CDS	64941254	64941331	+

Transcript Sequence
>GWHTAAZE011555 ATGAAACTTACAAAGATGCATGTGAAGTTTCTTCTTGCTCGTACATCAGTTCAAAATTGTTGTAAGGTTTGCTCTGGGGATTGTTTACGAGAAATACTTTGTGCTTGTGCCGGTGAAACTGGGGGTAAATTTGCTTACACACCAGAGGGGTGTTGTGATGCTAATGTGGTTGAGATTCCTGTTGAAGTTGAGACACCCGATCACTACTATTACCACCTTGCTTTCTTCACTACAAGGAAGGTAAATGCTTTGGAAGAGCTAACTTGGGATTACGGTGTTGATTTTGATGATCATACTGATCCTGGGAAGCTGTCTCTGTGGAAGCAAATTCTGCAGGAACATTAA

Network for GWHGAAZE011543

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00856.29	SET	52	92	3.10E-05

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	SET

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.138
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.187
	SRR3591710	White floral bud	0.207
	SRR3591711	White flower	0.472
	SRR3591712	Green floral bud	0.055
	SRR3591713	Yellow flower	0.108
SRP173429	SRR8316895	Juvenile bud stage	1.613
	SRR8316896	Juvenile bud stage	1.161
	SRR8316897	Juvenile bud stage	0.684
	SRR8316894	Third green stage	0.389
	SRR8316900	Third green stage	0.441
	SRR8316901	Third green stage	0.792
	SRR8316898	Complete white stage	0.491
	SRR8316899	Complete white stage	1.077
	SRR8316903	Complete white stage	0.488
	SRR8316902	Silver flowering stage	0.506
	SRR8316904	Silver flowering stage	0.729
	SRR8316905	Silver flowering stage	0.089
	SRR8316906	Gold flowering stage	1.074
	SRR8316907	Gold flowering stage	2.292
	SRR8316908	Gold flowering stage	2.280
SRP132670	SRR6706286	Control	0.119
	SRR6706287	Light intensity 50%	0.316
	SRR6706288	Light intensity 20%	0.338
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.803
	CNS0095593	Slightly white alabastrum(diploid) 2	1.210
	CNS0095594	Slightly white alabastrum(diploid) 3	0.331
	CNS0095595	Whole white alabastrum(diploid) 2	0.816
	CNS0095596	Whole white alabastrum(diploid) 3	0.154
	CNS0095597	Whole white alabastrum(diploid) 4	0.909
	CNS0095598	Silvery flower (diploied) 1	0.552
	CNS0095599	Silvery flower (diploied) 2	0.743
	CNS0095600	Silvery flower (diploied) 3	2.397
	CNS0095601	Golden flower (diploid) 1	2.049
	CNS0095602	Golden flower (diploid) 2	1.056
	CNS0095603	Golden flower (diploid) 3	1.022
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.116
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.315
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.678
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.235
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.207
	CNS0095610	Silvery flower (tetraploid) 1	1.174
	CNS0095611	Silvery flower (tetraploid) 2	0.368
	CNS0095612	Silvery flower (tetraploid) 3	1.236
	CNS0095613	Golden flower (tetraploid) 1	0.667
	CNS0095614	Golden flower (tetraploid) 2	1.514
	CNS0095615	Golden flower (tetraploid) 3	0.122
CRA001975	CRR073297	Stem 1	0.800
	CRR073298	Stem 2	0.458
	CRR073299	Stem 3	0.180
	CRR073300	Leaf 1	0.406
	CRR073301	Leaf 2	0.508
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.234
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.184
	CRR073306	Third green 1	0.198
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.413
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.700
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.046
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.475
	CRR073320	Tawny withering 3	0.488