Gene detail

Detail information of GWHGAAZE011545

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP16772.1	1.6634E-46	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9LNT9\|ASK4_ARATH	5E-42	SKP1-like protein 4
trEMBL	tr\|A0A068V8A6\|A0A068V8A6_COFCA	6E-47	Coffea canephora DH200=94 genomic scaffold, scaffold_136 {ECO:0000313\|EMBL:CDP16772.1}
TAIR10	AT1G20140.1	4E-34	SKP1-like 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	64954191	64954643	+
GWHAAZE00000003	mRNA	64954191	64954643	+
GWHAAZE00000003	exon	64954191	64954643	+
GWHAAZE00000003	CDS	64954191	64954643	+

Transcript Sequence
>GWHTAAZE011557 ATGTCAAAATCGCAAGAAAAGAAATTGGTAACATTGAAGAGCTCCGATAAAGAAGAATTCGTCGTTGAAGAGTCGATTGCGGTCACATCGGAGACAATAAAGAACATCATCGAAGACTGTGGACTTGAGTTGATCCCTCTGCCTAACGTCGACGGCAAAACCCTAGCTAAGGTAATCGAGTACTGCACCAAACATTCTACTGGTTCTAATGATGATAGTAAATTCGACGGCGAGTTCCTTGATACGAAACAAATATCGGTTCTAGTCGATATGCTACTGGCTGCTAATTATCTCAACATTAAGAGCTTGTTCGAAAAAGTTTGTACGAAAATAGCTGATCGCATTAAAGATATGAGTGTGGAGGAGGTTCGCGAAGTATTTAAGATCGAGAACGACTTCACACCCGAGGAAGAGAAGAAGATCCGAGATGAACACGCATGGGCTCATGAGTAA

Network for GWHGAAZE011545

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03931.16	Skp1_POZ	9	66	3.60E-21
PF01466.20	Skp1	101	148	1.50E-19

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	SKP1

KEGG pathway

KO	Enzyme	pathway	mapID
K03094	SKP1, CBF3D	Protein processing in endoplasmic reticulum	map04141
		Ubiquitin mediated proteolysis	map04120
		Wnt signaling pathway	map04310
		Hedgehog signaling pathway - fly	map04341
		TGF-beta signaling pathway	map04350
		Cell cycle	map04110
		Cell cycle - yeast	map04111
		Oocyte meiosis	map04114
		Circadian rhythm	map04710

Gene Ontology

GO term	Ontology	Name
GO:0006511	biological_process	ubiquitin-dependent protein catabolic process

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.403
	SRR3591706	second leaf	0.073
	SRR3591707	mature leaf	0.060
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.869
	SRR3591710	White floral bud	0.350
	SRR3591711	White flower	0.188
	SRR3591712	Green floral bud	0.233
	SRR3591713	Yellow flower	0.622
SRP173429	SRR8316895	Juvenile bud stage	6.672
	SRR8316896	Juvenile bud stage	2.755
	SRR8316897	Juvenile bud stage	0.526
	SRR8316894	Third green stage	0.275
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.037
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.036
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.222
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.016
	SRR6706288	Light intensity 20%	0.004
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	1.723
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.265
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.314
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.465
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.148
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.494
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.302
	CNS0095610	Silvery flower (tetraploid) 1	0.448
	CNS0095611	Silvery flower (tetraploid) 2	0.125
	CNS0095612	Silvery flower (tetraploid) 3	0.484
	CNS0095613	Golden flower (tetraploid) 1	0.163
	CNS0095614	Golden flower (tetraploid) 2	0.359
	CNS0095615	Golden flower (tetraploid) 3	0.267
CRA001975	CRR073297	Stem 1	2.655
	CRR073298	Stem 2	0.956
	CRR073299	Stem 3	4.473
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.010
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.008
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.007
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.025