Gene detail

Detail information of GWHGAAZE011787

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010256119.1	1.0449E-99	PREDICTED: 50S ribosomal protein L24, chloroplastic [Nelumbo nucifera]
Swissprot	tr\|A6MW12\|RK24_RHDSA	8E-14	50S ribosomal protein L24, chloroplastic
trEMBL	tr\|I3T887\|I3T887_MEDTR	6E-98	Uncharacterized protein {ECO:0000313\|EMBL:AFK48729.1}
TAIR10	AT5G23535.1	5E-74	KOW domain-containing protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	73172372	73174941	-
GWHAAZE00000003	mRNA	73172372	73174941	-
GWHAAZE00000003	exon	73172372	73172454	-
GWHAAZE00000003	exon	73172964	73173100	-
GWHAAZE00000003	exon	73173206	73173309	-
GWHAAZE00000003	exon	73174708	73174803	-
GWHAAZE00000003	exon	73174882	73174941	-
GWHAAZE00000003	CDS	73174882	73174941	-
GWHAAZE00000003	CDS	73174708	73174803	-
GWHAAZE00000003	CDS	73173206	73173309	-
GWHAAZE00000003	CDS	73172964	73173100	-
GWHAAZE00000003	CDS	73172372	73172454	-

Transcript Sequence
>GWHTAAZE011799 ATGGGTTGGAAAGCAGCTCAAAAGCTGATTCAGAATTGGAAGATTCTTAGAGGAGACAATGTGATCATAACCAGGGGTAAGGATAGAGGTGAAACTGGACTAATAAAGCGCGTCATTCGTTCTCAAAATCGTGTTATTGTTGAAGGGAAAAATTTGGTAAAGAAACACATCAAACAAGGGCAAGGTCATGAAGGTGGAATATTTACAGTTGAAGCCCCTCTTCATGCCTCAAATGTTCAAGTTCTTGACCCAGTCACAGGAAAGCCTTGTAAGATTGGAAGTAGATACTTAGAAGATGGTACCAAAGTAAGGGTTTCTAGAGGTCAAGGTGCATCAGGGTCCATCATTCCTCGTCCCGAGATCTTGAAAGTACGAACAACACCACGTCCTACAATAGTGGGGCCAAAAGATACGCCAATGGAATTCGTGGAGGTGAAGACTTATGATGCTAAAACAGGAAGGGGCATGCCCGAACTTTAG

Network for GWHGAAZE011787

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00467.30	KOW	17	48	5.90E-08
PF17136.5	ribosomal_L24	51	111	7.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02895	RP-L24, MRPL24, rplX	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0003735	molecular_function	structural constituent of ribosome

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	23.570
	SRR3591706	second leaf	15.651
	SRR3591707	mature leaf	7.889
	SRR3591708	Shoot apex	36.111
	SRR3591709	Stem	14.405
	SRR3591710	White floral bud	23.359
	SRR3591711	White flower	21.331
	SRR3591712	Green floral bud	26.850
	SRR3591713	Yellow flower	14.684
SRP173429	SRR8316895	Juvenile bud stage	17.859
	SRR8316896	Juvenile bud stage	23.961
	SRR8316897	Juvenile bud stage	13.032
	SRR8316894	Third green stage	10.918
	SRR8316900	Third green stage	19.261
	SRR8316901	Third green stage	19.470
	SRR8316898	Complete white stage	4.954
	SRR8316899	Complete white stage	18.388
	SRR8316903	Complete white stage	11.854
	SRR8316902	Silver flowering stage	5.793
	SRR8316904	Silver flowering stage	6.550
	SRR8316905	Silver flowering stage	3.524
	SRR8316906	Gold flowering stage	7.682
	SRR8316907	Gold flowering stage	8.425
	SRR8316908	Gold flowering stage	12.291
SRP132670	SRR6706286	Control	18.312
	SRR6706287	Light intensity 50%	18.269
	SRR6706288	Light intensity 20%	21.051
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	26.704
	CNS0095593	Slightly white alabastrum(diploid) 2	25.590
	CNS0095594	Slightly white alabastrum(diploid) 3	27.983
	CNS0095595	Whole white alabastrum(diploid) 2	18.191
	CNS0095596	Whole white alabastrum(diploid) 3	17.436
	CNS0095597	Whole white alabastrum(diploid) 4	13.664
	CNS0095598	Silvery flower (diploied) 1	18.619
	CNS0095599	Silvery flower (diploied) 2	15.750
	CNS0095600	Silvery flower (diploied) 3	9.798
	CNS0095601	Golden flower (diploid) 1	21.380
	CNS0095602	Golden flower (diploid) 2	10.387
	CNS0095603	Golden flower (diploid) 3	9.362
	CNS0095604	Slightly white alabastrum(tetraploid) 1	39.092
	CNS0095605	Slightly white alabastrum(tetraploid) 2	38.753
	CNS0095606	Slightly white alabastrum(tetraploid) 3	37.972
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.216
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.224
	CNS0095609	Whole white alabastrum(tetraploid) 3	22.255
	CNS0095610	Silvery flower (tetraploid) 1	9.287
	CNS0095611	Silvery flower (tetraploid) 2	10.908
	CNS0095612	Silvery flower (tetraploid) 3	11.104
	CNS0095613	Golden flower (tetraploid) 1	8.731
	CNS0095614	Golden flower (tetraploid) 2	11.101
	CNS0095615	Golden flower (tetraploid) 3	3.328
CRA001975	CRR073297	Stem 1	17.087
	CRR073298	Stem 2	14.937
	CRR073299	Stem 3	12.956
	CRR073300	Leaf 1	9.943
	CRR073301	Leaf 2	12.394
	CRR073302	Leaf 3	10.638
	CRR073303	Juvenile bud 1	10.412
	CRR073304	Juvenile bud 2	3.655
	CRR073305	Juvenile bud 3	5.827
	CRR073306	Third green 1	0.764
	CRR073307	Third green 2	0.863
	CRR073308	Third green 3	1.079
	CRR073309	Second white 1	1.327
	CRR073310	Second white 2	1.549
	CRR073311	Second white 3	1.054
	CRR073312	Silver flowering 1	0.886
	CRR073313	Silver flowering 2	1.029
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	4.146
	CRR073316	Gold flowering 2	6.741
	CRR073317	Gold flowering 3	3.347
	CRR073318	Tawny withering 1	12.586
	CRR073319	Tawny withering 2	7.429
	CRR073320	Tawny withering 3	13.715