Gene detail

Detail information of GWHGAAZE011788

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009594840.1	8.3346E-135	PREDICTED: proteasome subunit beta type-2-A [Nicotiana tomentosiformis]
Swissprot	tr\|O23714\|PSB2A_ARATH	4E-126	Proteasome subunit beta type-2-A
trEMBL	tr\|M1D5K4\|M1D5K4_SOLTU	9E-135	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400082075}
TAIR10	AT3G22630.1	1E-99	20S proteasome beta subunit D1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	73195394	73202368	+
GWHAAZE00000003	mRNA	73195394	73202368	+
GWHAAZE00000003	exon	73195394	73195551	+
GWHAAZE00000003	exon	73196331	73196454	+
GWHAAZE00000003	exon	73202036	73202368	+
GWHAAZE00000003	CDS	73195394	73195551	+
GWHAAZE00000003	CDS	73196331	73196454	+
GWHAAZE00000003	CDS	73202036	73202368	+

Transcript Sequence
>GWHTAAZE011800 ATGGAGTGTGTATTTGGATTGGTGGGCAAAGATTACGCTCTGGTAGTAGCAGATTCATCGGCGGTACACAGCATACTAGTTCACAAATGCAACGAAGACAAGATCATGCTCCTCGATTCGCACAAGCTCATGGGCGCTAGCGGCGAAGCTGGTGACAGAGCTCAATTCACTGAGTACATTCAGAAGAACGTGGCTTTGTATCAGTTTCGGAATGGTATCCCACTGACCACTGCGGCTGCTGCAAATTTCACTCGGGGTGAGCTCGCTACTGCGTTGCGGAAGAACCCGTACTCCGTGAATATCATACTCGCGGGCTATGACAAGGAAACCGGACCCTCTCTCTACTACATTGATTATATCGCGTCCCTCCACAAGGTGGACAGGGCAGCATTTGGATATGGCTCCTATTTCTCGCTCTCCATGATGGATAGGTACTACCGCAGTGACATGACGGTTGAAGAAGCCGTTGAATTGGTTGATAAGGTCATTTTAGAGATACGATCAAGGCTGGTAGTGGCCCCGCCAAACTTCGTAATCAAGATTGTTGATAAGGATGGAGCCAGGGAATATGCTTGGCGCGAATCTGTCAAGGACGCCCCCTTTTCTTCAGCCTGA

Network for GWHGAAZE011788

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0060

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00227.27	Proteasome	3	182	1.30E-40

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02734	PSMB2	Proteasome	map03050

Gene Ontology

GO term	Ontology	Name
GO:0051603	biological_process	proteolysis involved in cellular protein catabolic process
GO:0005839	cellular_component	proteasome core complex
GO:0004298	molecular_function	threonine-type endopeptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	172.762
	SRR3591706	second leaf	73.436
	SRR3591707	mature leaf	57.676
	SRR3591708	Shoot apex	164.552
	SRR3591709	Stem	103.201
	SRR3591710	White floral bud	112.924
	SRR3591711	White flower	226.572
	SRR3591712	Green floral bud	141.393
	SRR3591713	Yellow flower	175.428
SRP173429	SRR8316895	Juvenile bud stage	92.653
	SRR8316896	Juvenile bud stage	150.127
	SRR8316897	Juvenile bud stage	65.627
	SRR8316894	Third green stage	51.893
	SRR8316900	Third green stage	189.315
	SRR8316901	Third green stage	181.220
	SRR8316898	Complete white stage	84.772
	SRR8316899	Complete white stage	211.173
	SRR8316903	Complete white stage	99.241
	SRR8316902	Silver flowering stage	105.818
	SRR8316904	Silver flowering stage	111.636
	SRR8316905	Silver flowering stage	50.870
	SRR8316906	Gold flowering stage	255.077
	SRR8316907	Gold flowering stage	258.293
	SRR8316908	Gold flowering stage	257.225
SRP132670	SRR6706286	Control	163.917
	SRR6706287	Light intensity 50%	170.126
	SRR6706288	Light intensity 20%	186.596
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	184.804
	CNS0095593	Slightly white alabastrum(diploid) 2	238.608
	CNS0095594	Slightly white alabastrum(diploid) 3	187.459
	CNS0095595	Whole white alabastrum(diploid) 2	167.872
	CNS0095596	Whole white alabastrum(diploid) 3	172.526
	CNS0095597	Whole white alabastrum(diploid) 4	145.905
	CNS0095598	Silvery flower (diploied) 1	130.615
	CNS0095599	Silvery flower (diploied) 2	158.328
	CNS0095600	Silvery flower (diploied) 3	204.533
	CNS0095601	Golden flower (diploid) 1	137.209
	CNS0095602	Golden flower (diploid) 2	176.059
	CNS0095603	Golden flower (diploid) 3	169.080
	CNS0095604	Slightly white alabastrum(tetraploid) 1	179.853
	CNS0095605	Slightly white alabastrum(tetraploid) 2	167.244
	CNS0095606	Slightly white alabastrum(tetraploid) 3	209.498
	CNS0095607	Whole white alabastrum(tetraploid) 1	108.756
	CNS0095608	Whole white alabastrum(tetraploid) 2	114.619
	CNS0095609	Whole white alabastrum(tetraploid) 3	178.853
	CNS0095610	Silvery flower (tetraploid) 1	243.875
	CNS0095611	Silvery flower (tetraploid) 2	198.763
	CNS0095612	Silvery flower (tetraploid) 3	160.987
	CNS0095613	Golden flower (tetraploid) 1	213.621
	CNS0095614	Golden flower (tetraploid) 2	204.728
	CNS0095615	Golden flower (tetraploid) 3	234.837
CRA001975	CRR073297	Stem 1	160.215
	CRR073298	Stem 2	154.518
	CRR073299	Stem 3	206.317
	CRR073300	Leaf 1	196.894
	CRR073301	Leaf 2	212.676
	CRR073302	Leaf 3	242.039
	CRR073303	Juvenile bud 1	279.501
	CRR073304	Juvenile bud 2	247.902
	CRR073305	Juvenile bud 3	209.682
	CRR073306	Third green 1	146.730
	CRR073307	Third green 2	160.158
	CRR073308	Third green 3	137.112
	CRR073309	Second white 1	220.683
	CRR073310	Second white 2	185.236
	CRR073311	Second white 3	135.649
	CRR073312	Silver flowering 1	120.472
	CRR073313	Silver flowering 2	125.392
	CRR073314	Silver flowering 3	112.238
	CRR073315	Gold flowering 1	124.176
	CRR073316	Gold flowering 2	107.279
	CRR073317	Gold flowering 3	109.574
	CRR073318	Tawny withering 1	174.708
	CRR073319	Tawny withering 2	155.098
	CRR073320	Tawny withering 3	172.178