Gene detail

Detail information of GWHGAAZE011846

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI26214.3	6.41697E-86	unnamed protein product [Vitis vinifera]
Swissprot	tr\|Q9M651\|RAGP2_ARATH	4E-65	RAN GTPase-activating protein 2
trEMBL	tr\|A0A061ELQ9\|A0A061ELQ9_THECC	5E-80	RAN GTPase activating protein 2 {ECO:0000313\|EMBL:EOY05608.1}
TAIR10	AT5G19320.1	1E-55	RAN GTPase activating protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	74087779	74088540	+
GWHAAZE00000003	mRNA	74087779	74088540	+
GWHAAZE00000003	exon	74087779	74088046	+
GWHAAZE00000003	exon	74088242	74088540	+
GWHAAZE00000003	CDS	74087779	74088046	+
GWHAAZE00000003	CDS	74088242	74088540	+

Transcript Sequence
>GWHTAAZE011858 ATGAATATTTTCTCGAAAGCATTGGACGGTTGTGATTTAAAGTCTTTGAATCTATCAAACAACGCTCTGGGTGAGAAGGGCGTTAGGGCATTTGGATTGCTTCTAAAATCACAGACTAATTTAGAGGAATTGTATTTAATGAACGACGGAATCTCGGAGAAAGCTGCAAGATCTGTTTGCGAGTTAATCCCTTCGACGGAGAGGCTTAGAGTTCTCCATTTTCATAATAACATGACCGGAGACGAAGGGGCTGTCGCTATTTCTCAAGAGCTTTATATCAGCTACTTGAATTTGGAAGACGACGGTGCAATTTCTATATCCAATGTTCTCAAGCAAACAGCCCCTAATCTTGAGGTATTAGAAATGTCTGGTAACGACATAACCGCCGATGCGGCCCCTAGTTTAGCTTCTTGTATAGAATCAAAGCATTGTCTCACCCGGCTTAACTTGGCTGAGAATGAATTTAAAGATGAGGGTACAACTCATATAAGCAAGGCATTGGAAAAAGGACATGATAAATTGGAAGAAGTTGATATGAGCATCAACTGTATAAGACGAGTTGGCGCT

Network for GWHGAAZE011846

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13516.7	LRR_6	12	31	0.025
PF13516.7	LRR_6	115	132	0.21
PF13516.7	LRR_6	142	161	0.073

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14319	RANGAP1	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.506
	SRR3591706	second leaf	3.995
	SRR3591707	mature leaf	2.325
	SRR3591708	Shoot apex	2.214
	SRR3591709	Stem	1.927
	SRR3591710	White floral bud	2.608
	SRR3591711	White flower	4.393
	SRR3591712	Green floral bud	2.873
	SRR3591713	Yellow flower	1.826
SRP173429	SRR8316895	Juvenile bud stage	1.702
	SRR8316896	Juvenile bud stage	1.798
	SRR8316897	Juvenile bud stage	1.610
	SRR8316894	Third green stage	0.951
	SRR8316900	Third green stage	2.835
	SRR8316901	Third green stage	2.541
	SRR8316898	Complete white stage	0.694
	SRR8316899	Complete white stage	2.929
	SRR8316903	Complete white stage	2.609
	SRR8316902	Silver flowering stage	1.037
	SRR8316904	Silver flowering stage	1.829
	SRR8316905	Silver flowering stage	0.912
	SRR8316906	Gold flowering stage	2.488
	SRR8316907	Gold flowering stage	2.270
	SRR8316908	Gold flowering stage	3.728
SRP132670	SRR6706286	Control	2.540
	SRR6706287	Light intensity 50%	2.872
	SRR6706288	Light intensity 20%	2.989
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.619
	CNS0095593	Slightly white alabastrum(diploid) 2	2.301
	CNS0095594	Slightly white alabastrum(diploid) 3	2.161
	CNS0095595	Whole white alabastrum(diploid) 2	2.758
	CNS0095596	Whole white alabastrum(diploid) 3	2.246
	CNS0095597	Whole white alabastrum(diploid) 4	3.343
	CNS0095598	Silvery flower (diploied) 1	3.504
	CNS0095599	Silvery flower (diploied) 2	2.955
	CNS0095600	Silvery flower (diploied) 3	3.430
	CNS0095601	Golden flower (diploid) 1	3.601
	CNS0095602	Golden flower (diploid) 2	2.884
	CNS0095603	Golden flower (diploid) 3	3.210
	CNS0095604	Slightly white alabastrum(tetraploid) 1	2.828
	CNS0095605	Slightly white alabastrum(tetraploid) 2	2.292
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.516
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.063
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.325
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.405
	CNS0095610	Silvery flower (tetraploid) 1	2.230
	CNS0095611	Silvery flower (tetraploid) 2	2.900
	CNS0095612	Silvery flower (tetraploid) 3	4.489
	CNS0095613	Golden flower (tetraploid) 1	2.067
	CNS0095614	Golden flower (tetraploid) 2	1.827
	CNS0095615	Golden flower (tetraploid) 3	3.318
CRA001975	CRR073297	Stem 1	1.509
	CRR073298	Stem 2	1.257
	CRR073299	Stem 3	1.451
	CRR073300	Leaf 1	4.013
	CRR073301	Leaf 2	2.112
	CRR073302	Leaf 3	1.549
	CRR073303	Juvenile bud 1	1.910
	CRR073304	Juvenile bud 2	1.024
	CRR073305	Juvenile bud 3	1.324
	CRR073306	Third green 1	1.391
	CRR073307	Third green 2	0.751
	CRR073308	Third green 3	0.979
	CRR073309	Second white 1	2.396
	CRR073310	Second white 2	1.982
	CRR073311	Second white 3	2.132
	CRR073312	Silver flowering 1	2.444
	CRR073313	Silver flowering 2	2.202
	CRR073314	Silver flowering 3	1.786
	CRR073315	Gold flowering 1	3.677
	CRR073316	Gold flowering 2	1.592
	CRR073317	Gold flowering 3	1.760
	CRR073318	Tawny withering 1	1.367
	CRR073319	Tawny withering 2	0.962
	CRR073320	Tawny withering 3	1.434