Gene detail

Detail information of GWHGAAZE011993

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002517015.1	1.24771E-98	40S ribosomal protein S15, putative [Ricinus communis]
Swissprot	tr\|P31674\|RS15_ORYSJ	7E-96	40S ribosomal protein S15
trEMBL	tr\|B9RTE6\|B9RTE6_RICCO	5E-99	40S ribosomal protein S15, putative {ECO:0000313\|EMBL:EEF45178.1}
TAIR10	AT5G09500.1	1E-70	Ribosomal protein S19 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	78028302	78031206	+
GWHAAZE00000003	mRNA	78028302	78031206	+
GWHAAZE00000003	exon	78028302	78028304	+
GWHAAZE00000003	exon	78028391	78028536	+
GWHAAZE00000003	exon	78028648	78028705	+
GWHAAZE00000003	exon	78030958	78031206	+
GWHAAZE00000003	CDS	78028302	78028304	+
GWHAAZE00000003	CDS	78028391	78028536	+
GWHAAZE00000003	CDS	78028648	78028705	+
GWHAAZE00000003	CDS	78030958	78031206	+

Transcript Sequence
>GWHTAAZE012005 ATGGCGGAAGTAGAGACAGATGTCGCGACAGGAGTGCCGAGGAAGAGGACGTTCAAGAAGTTCAGCTTCAGGGGAGTCGATCTCGATGCTCTTCTTGACATGTCCACCGATGACCTCGTCAAGCTCTTCACTGCCCGTGCTCGCCGAAGGTTTCAGAGAGGTCTAAAAAGGAAGCCTATGGCTTTGATCAAGAAGCTGCGCAAGGCTAAACGGGAGGCGCCAGCTGGCGAGAAGCCAGAACTTGTGAAGACCCACCTGCGCAACATGATCATTGTACCTGAGATGATTGGAAGTGTCGTCGGTGTGTACAACGGCAAGACCTTCAATCAGATTGAGATCAAGCCCGAGATGATTGGCCACTACTTGGCAGAGTTCTCCATATCGTACAAGCCGGTCAAGCACGGAAGACCCGGTATCGGTGCCACCCACTCGTCCAGGTTCATTCCTCTCAAGTGA

Network for GWHGAAZE011993

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00203.22	Ribosomal_S19	49	134	2.80E-33

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02958	RP-S15e, RPS15	Ribosome	map03010

Gene Ontology

GO term	Ontology	Name
GO:0006412	biological_process	translation
GO:0005840	cellular_component	ribosome
GO:0015935	cellular_component	small ribosomal subunit
GO:0003735	molecular_function	structural constituent of ribosome
GO:0003723	molecular_function	RNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	188.177
	SRR3591706	second leaf	83.498
	SRR3591707	mature leaf	52.257
	SRR3591708	Shoot apex	220.908
	SRR3591709	Stem	99.989
	SRR3591710	White floral bud	96.978
	SRR3591711	White flower	104.170
	SRR3591712	Green floral bud	187.021
	SRR3591713	Yellow flower	76.964
SRP173429	SRR8316895	Juvenile bud stage	127.005
	SRR8316896	Juvenile bud stage	173.227
	SRR8316897	Juvenile bud stage	84.090
	SRR8316894	Third green stage	79.329
	SRR8316900	Third green stage	235.395
	SRR8316901	Third green stage	263.662
	SRR8316898	Complete white stage	57.078
	SRR8316899	Complete white stage	282.366
	SRR8316903	Complete white stage	75.683
	SRR8316902	Silver flowering stage	50.915
	SRR8316904	Silver flowering stage	45.764
	SRR8316905	Silver flowering stage	21.284
	SRR8316906	Gold flowering stage	77.860
	SRR8316907	Gold flowering stage	91.024
	SRR8316908	Gold flowering stage	98.306
SRP132670	SRR6706286	Control	322.483
	SRR6706287	Light intensity 50%	320.722
	SRR6706288	Light intensity 20%	355.029
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	218.241
	CNS0095593	Slightly white alabastrum(diploid) 2	264.901
	CNS0095594	Slightly white alabastrum(diploid) 3	215.070
	CNS0095595	Whole white alabastrum(diploid) 2	199.103
	CNS0095596	Whole white alabastrum(diploid) 3	229.623
	CNS0095597	Whole white alabastrum(diploid) 4	161.111
	CNS0095598	Silvery flower (diploied) 1	135.714
	CNS0095599	Silvery flower (diploied) 2	126.123
	CNS0095600	Silvery flower (diploied) 3	117.883
	CNS0095601	Golden flower (diploid) 1	141.509
	CNS0095602	Golden flower (diploid) 2	117.724
	CNS0095603	Golden flower (diploid) 3	115.570
	CNS0095604	Slightly white alabastrum(tetraploid) 1	201.059
	CNS0095605	Slightly white alabastrum(tetraploid) 2	219.827
	CNS0095606	Slightly white alabastrum(tetraploid) 3	293.409
	CNS0095607	Whole white alabastrum(tetraploid) 1	126.640
	CNS0095608	Whole white alabastrum(tetraploid) 2	120.111
	CNS0095609	Whole white alabastrum(tetraploid) 3	215.409
	CNS0095610	Silvery flower (tetraploid) 1	109.765
	CNS0095611	Silvery flower (tetraploid) 2	99.432
	CNS0095612	Silvery flower (tetraploid) 3	82.198
	CNS0095613	Golden flower (tetraploid) 1	73.981
	CNS0095614	Golden flower (tetraploid) 2	87.195
	CNS0095615	Golden flower (tetraploid) 3	57.826
CRA001975	CRR073297	Stem 1	228.872
	CRR073298	Stem 2	238.774
	CRR073299	Stem 3	275.407
	CRR073300	Leaf 1	267.230
	CRR073301	Leaf 2	294.089
	CRR073302	Leaf 3	345.431
	CRR073303	Juvenile bud 1	280.309
	CRR073304	Juvenile bud 2	221.307
	CRR073305	Juvenile bud 3	235.223
	CRR073306	Third green 1	41.426
	CRR073307	Third green 2	46.014
	CRR073308	Third green 3	47.141
	CRR073309	Second white 1	58.010
	CRR073310	Second white 2	41.535
	CRR073311	Second white 3	29.041
	CRR073312	Silver flowering 1	54.026
	CRR073313	Silver flowering 2	86.793
	CRR073314	Silver flowering 3	58.371
	CRR073315	Gold flowering 1	127.137
	CRR073316	Gold flowering 2	140.154
	CRR073317	Gold flowering 3	162.027
	CRR073318	Tawny withering 1	209.469
	CRR073319	Tawny withering 2	187.109
	CRR073320	Tawny withering 3	200.976