Gene detail

Detail information of GWHGAAZE012064

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004241017.1	1.09818E-98	PREDICTED: serine/threonine-protein kinase BLUS1 [Solanum lycopersicum]
Swissprot	tr\|O23304\|BLUS1_ARATH	1E-85	Serine/threonine-protein kinase BLUS1
trEMBL	tr\|K4C660\|K4C660_SOLLC	4E-99	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc06g053730.1.1}
TAIR10	AT4G14480.1	2E-71	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	79495391	79496038	+
GWHAAZE00000003	mRNA	79495391	79496038	+
GWHAAZE00000003	exon	79495391	79496038	+
GWHAAZE00000003	CDS	79495391	79496038	+

Transcript Sequence
>GWHTAAZE012076 ATGGCTAATCAAGAACATGAAGAATCAAGAAAGCTTCAATACCCACTTGACTCAAACAGTTACAAGATCCTCAATGAAATTGGCCGAGGCCTAAGCGCAATTGTCTACAAGGCAATATGCATACCCATGAACAACTCTCCCGTGGCCATAAAAACCATCGATCTTGATCGATCTCGAGCCGATTTGGAGAATGTTCGACGAGAGGCCAAGACCATGTCCCTGCTTTCTCATCCCAACATTCTCAAGGCGCTATGTTCCTTCACAGTTGATCGCCGCCTTTGGGTCGTAATGCCCTTCATGTGCGCCGGTTCTTTGCAGTCAATCATAGCTTCTTGTTTCCCCAACGGCCTGTCCGAGCCTTGCATCACTATAATCCTCAAAGAAACCCTAATCGCATTGTTGTATCTTCACAATCAAGGGCATATTCACAGAGACATCAAGGCTGGTAATATTCTTATGGACTCGAATGGGTCAATTAAGCTGGCAGATTTTGGGGTCTCGGCTTCAATTTATGAAGCAAATTCTACTTCGATGTTTACGGAATTTGCAGGAACCCCCTACTGGATGGCCCCGAGGTGGTTCATTCTCATAAAGGGTATAGCTTCAAGGCCGATATATGGTCTTTCGGTATCACTGCTTTGGAATTAG

Network for GWHGAAZE012064

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	21	193	1.20E-37

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE20-Fray

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.609
	SRR3591706	second leaf	8.863
	SRR3591707	mature leaf	3.220
	SRR3591708	Shoot apex	5.197
	SRR3591709	Stem	2.962
	SRR3591710	White floral bud	2.607
	SRR3591711	White flower	1.558
	SRR3591712	Green floral bud	3.748
	SRR3591713	Yellow flower	1.328
SRP173429	SRR8316895	Juvenile bud stage	5.743
	SRR8316896	Juvenile bud stage	6.423
	SRR8316897	Juvenile bud stage	3.116
	SRR8316894	Third green stage	3.120
	SRR8316900	Third green stage	4.766
	SRR8316901	Third green stage	5.646
	SRR8316898	Complete white stage	1.065
	SRR8316899	Complete white stage	5.045
	SRR8316903	Complete white stage	2.039
	SRR8316902	Silver flowering stage	1.281
	SRR8316904	Silver flowering stage	1.157
	SRR8316905	Silver flowering stage	0.703
	SRR8316906	Gold flowering stage	5.102
	SRR8316907	Gold flowering stage	2.505
	SRR8316908	Gold flowering stage	10.478
SRP132670	SRR6706286	Control	4.928
	SRR6706287	Light intensity 50%	4.274
	SRR6706288	Light intensity 20%	4.929
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.469
	CNS0095593	Slightly white alabastrum(diploid) 2	3.147
	CNS0095594	Slightly white alabastrum(diploid) 3	4.181
	CNS0095595	Whole white alabastrum(diploid) 2	3.744
	CNS0095596	Whole white alabastrum(diploid) 3	2.782
	CNS0095597	Whole white alabastrum(diploid) 4	1.989
	CNS0095598	Silvery flower (diploied) 1	4.552
	CNS0095599	Silvery flower (diploied) 2	4.939
	CNS0095600	Silvery flower (diploied) 3	1.789
	CNS0095601	Golden flower (diploid) 1	4.510
	CNS0095602	Golden flower (diploid) 2	4.328
	CNS0095603	Golden flower (diploid) 3	3.728
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.642
	CNS0095605	Slightly white alabastrum(tetraploid) 2	5.902
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.183
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.337
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.775
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.077
	CNS0095610	Silvery flower (tetraploid) 1	4.350
	CNS0095611	Silvery flower (tetraploid) 2	5.131
	CNS0095612	Silvery flower (tetraploid) 3	4.690
	CNS0095613	Golden flower (tetraploid) 1	0.965
	CNS0095614	Golden flower (tetraploid) 2	3.695
	CNS0095615	Golden flower (tetraploid) 3	1.229
CRA001975	CRR073297	Stem 1	8.029
	CRR073298	Stem 2	6.564
	CRR073299	Stem 3	1.323
	CRR073300	Leaf 1	7.223
	CRR073301	Leaf 2	5.807
	CRR073302	Leaf 3	2.768
	CRR073303	Juvenile bud 1	1.627
	CRR073304	Juvenile bud 2	0.333
	CRR073305	Juvenile bud 3	1.541
	CRR073306	Third green 1	0.145
	CRR073307	Third green 2	0.404
	CRR073308	Third green 3	1.099
	CRR073309	Second white 1	0.137
	CRR073310	Second white 2	0.559
	CRR073311	Second white 3	1.460
	CRR073312	Silver flowering 1	0.518
	CRR073313	Silver flowering 2	0.738
	CRR073314	Silver flowering 3	0.334
	CRR073315	Gold flowering 1	7.612
	CRR073316	Gold flowering 2	9.439
	CRR073317	Gold flowering 3	6.618
	CRR073318	Tawny withering 1	2.004
	CRR073319	Tawny withering 2	0.862
	CRR073320	Tawny withering 3	1.115