Gene detail

Detail information of GWHGAAZE012065

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007150516.1	2.01092E-33	hypothetical protein PHAVU_005G158900g [Phaseolus vulgaris]
Swissprot	tr\|O23304\|BLUS1_ARATH	3E-31	Serine/threonine-protein kinase BLUS1
trEMBL	tr\|V7BZN2\|V7BZN2_PHAVU	8E-34	Uncharacterized protein {ECO:0000313\|EMBL:ESW22510.1}
TAIR10	AT4G14480.1	3E-20	Protein kinase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	79496089	79496334	+
GWHAAZE00000003	mRNA	79496089	79496334	+
GWHAAZE00000003	exon	79496089	79496334	+
GWHAAZE00000003	CDS	79496089	79496334	+

Transcript Sequence
>GWHTAAZE012077 ATGAAAATTACAAGGCGTTTTCGGTTCTCCGAATATGAAAAGAGCAATAATTGCAACAACAAGAAGTTCTCAAAGGCTTTCAAGGATATGGTGGGGATGTGTCTCGATCAAGATCCATCTAAGAGGCCATCTGCGGAGAAACTACTAAAGCATTCGTTTTTCAAGAACTGTAGAGGCTCGGATTTTCTTGTAAAGAATGTGCTACTGGATTTGCCATCTGTAGAGCAAAGGTACAATGAGACAAAG

Network for GWHGAAZE012065

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	STE_STE20-Fray

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.884
	SRR3591706	second leaf	6.723
	SRR3591707	mature leaf	10.028
	SRR3591708	Shoot apex	8.423
	SRR3591709	Stem	1.263
	SRR3591710	White floral bud	2.154
	SRR3591711	White flower	1.641
	SRR3591712	Green floral bud	2.396
	SRR3591713	Yellow flower	2.391
SRP173429	SRR8316895	Juvenile bud stage	6.986
	SRR8316896	Juvenile bud stage	8.228
	SRR8316897	Juvenile bud stage	2.478
	SRR8316894	Third green stage	3.010
	SRR8316900	Third green stage	5.853
	SRR8316901	Third green stage	7.292
	SRR8316898	Complete white stage	0.882
	SRR8316899	Complete white stage	4.637
	SRR8316903	Complete white stage	1.842
	SRR8316902	Silver flowering stage	0.592
	SRR8316904	Silver flowering stage	1.762
	SRR8316905	Silver flowering stage	0.459
	SRR8316906	Gold flowering stage	3.488
	SRR8316907	Gold flowering stage	1.850
	SRR8316908	Gold flowering stage	13.560
SRP132670	SRR6706286	Control	4.051
	SRR6706287	Light intensity 50%	4.345
	SRR6706288	Light intensity 20%	5.127
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.821
	CNS0095593	Slightly white alabastrum(diploid) 2	1.947
	CNS0095594	Slightly white alabastrum(diploid) 3	2.337
	CNS0095595	Whole white alabastrum(diploid) 2	1.064
	CNS0095596	Whole white alabastrum(diploid) 3	2.186
	CNS0095597	Whole white alabastrum(diploid) 4	0.622
	CNS0095598	Silvery flower (diploied) 1	3.932
	CNS0095599	Silvery flower (diploied) 2	0.925
	CNS0095600	Silvery flower (diploied) 3	3.322
	CNS0095601	Golden flower (diploid) 1	3.016
	CNS0095602	Golden flower (diploid) 2	4.791
	CNS0095603	Golden flower (diploid) 3	2.664
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.942
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.878
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.812
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.892
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.038
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.203
	CNS0095610	Silvery flower (tetraploid) 1	0.891
	CNS0095611	Silvery flower (tetraploid) 2	4.950
	CNS0095612	Silvery flower (tetraploid) 3	3.166
	CNS0095613	Golden flower (tetraploid) 1	1.027
	CNS0095614	Golden flower (tetraploid) 2	1.103
	CNS0095615	Golden flower (tetraploid) 3	0.659
CRA001975	CRR073297	Stem 1	6.359
	CRR073298	Stem 2	7.333
	CRR073299	Stem 3	2.199
	CRR073300	Leaf 1	7.462
	CRR073301	Leaf 2	5.340
	CRR073302	Leaf 3	2.504
	CRR073303	Juvenile bud 1	2.235
	CRR073304	Juvenile bud 2	0.558
	CRR073305	Juvenile bud 3	1.787
	CRR073306	Third green 1	0.716
	CRR073307	Third green 2	0.401
	CRR073308	Third green 3	0.885
	CRR073309	Second white 1	0.621
	CRR073310	Second white 2	2.410
	CRR073311	Second white 3	1.794
	CRR073312	Silver flowering 1	1.766
	CRR073313	Silver flowering 2	3.309
	CRR073314	Silver flowering 3	0.370
	CRR073315	Gold flowering 1	11.652
	CRR073316	Gold flowering 2	10.625
	CRR073317	Gold flowering 3	10.506
	CRR073318	Tawny withering 1	2.072
	CRR073319	Tawny withering 2	4.134
	CRR073320	Tawny withering 3	2.602