Gene detail

Detail information of GWHGAAZE012258

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO98812.1	1.18028E-91	unnamed protein product [Coffea canephora]
Swissprot	tr\|P17641\|PRS1_SOLTU	9E-43	Pathogenesis-related protein STH-21
trEMBL	tr\|A0A068TS00\|A0A068TS00_COFCA	4E-92	Coffea canephora DH200=94 genomic scaffold, scaffold_3 {ECO:0000313\|EMBL:CDO98812.1}
TAIR10	AT1G14960.1	0.00005	Polyketide cyclase/dehydrase and lipid transport superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	82623125	82624297	-
GWHAAZE00000003	mRNA	82623125	82624297	-
GWHAAZE00000003	exon	82623125	82623423	-
GWHAAZE00000003	exon	82624114	82624297	-
GWHAAZE00000003	CDS	82624114	82624297	-
GWHAAZE00000003	CDS	82623125	82623423	-

Transcript Sequence
>GWHTAAZE012272 ATGGGTATAATCAAGATGTCTCAAACATTCAAGACAAAGGTGACTCCAAACAGGATGTTCAAGGCCTTGATCCTTGAATCCCACAAGCTCTGCCCACAGCTCATGTTTTCATCCATCAAAAGCATCGAATATACGGAGGGTGAAGGAGACGCCGGAAGCATCAAACAAATGAACTTTACCGAAGCTAGTCCATTGAAGTACGCAAAGTACAGAATTGATGAACTTGACAAAGAGGGATTCATGTGCAAATACACATTGCTTGAAACCGACGCGTTCATGGACAAGCTGGAATCGATTACTTACGAGGTGAAGTTTGAGCCATATGGGTATACAGGATGTGTTTGTAAGATTTCAAGTGAATACAAAACACGAGACAATGTAGAGATCAAAGAAGAAGACATCGAGCTCGGCAAAGATAGAGCCATTGGCATGTATGAAGTTGTCGAAGCCTACCTCTTGGCTCACCCTCATGCGTATACTTAA

Network for GWHGAAZE012258

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0211

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00407.20	Bet_v_1	7	154	7.60E-20

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0009738	biological_process	abscisic acid-activated signaling pathway
GO:0006952	biological_process	defense response
GO:0004864	molecular_function	protein phosphatase inhibitor activity
GO:0010427	molecular_function	abscisic acid binding
GO:0038023	molecular_function	signaling receptor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	36.072
	SRR3591706	second leaf	30.647
	SRR3591707	mature leaf	53.888
	SRR3591708	Shoot apex	25.818
	SRR3591709	Stem	68.097
	SRR3591710	White floral bud	15.590
	SRR3591711	White flower	62.324
	SRR3591712	Green floral bud	9.643
	SRR3591713	Yellow flower	143.819
SRP173429	SRR8316895	Juvenile bud stage	4.880
	SRR8316896	Juvenile bud stage	7.098
	SRR8316897	Juvenile bud stage	4.725
	SRR8316894	Third green stage	4.238
	SRR8316900	Third green stage	6.920
	SRR8316901	Third green stage	7.914
	SRR8316898	Complete white stage	7.509
	SRR8316899	Complete white stage	11.489
	SRR8316903	Complete white stage	8.998
	SRR8316902	Silver flowering stage	23.457
	SRR8316904	Silver flowering stage	19.999
	SRR8316905	Silver flowering stage	11.167
	SRR8316906	Gold flowering stage	83.902
	SRR8316907	Gold flowering stage	56.523
	SRR8316908	Gold flowering stage	87.336
SRP132670	SRR6706286	Control	15.502
	SRR6706287	Light intensity 50%	11.972
	SRR6706288	Light intensity 20%	11.689
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.844
	CNS0095593	Slightly white alabastrum(diploid) 2	11.006
	CNS0095594	Slightly white alabastrum(diploid) 3	12.875
	CNS0095595	Whole white alabastrum(diploid) 2	8.094
	CNS0095596	Whole white alabastrum(diploid) 3	5.762
	CNS0095597	Whole white alabastrum(diploid) 4	5.127
	CNS0095598	Silvery flower (diploied) 1	45.721
	CNS0095599	Silvery flower (diploied) 2	20.438
	CNS0095600	Silvery flower (diploied) 3	41.521
	CNS0095601	Golden flower (diploid) 1	45.783
	CNS0095602	Golden flower (diploid) 2	41.772
	CNS0095603	Golden flower (diploid) 3	42.879
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.127
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.334
	CNS0095606	Slightly white alabastrum(tetraploid) 3	14.443
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.108
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.610
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.366
	CNS0095610	Silvery flower (tetraploid) 1	41.286
	CNS0095611	Silvery flower (tetraploid) 2	44.248
	CNS0095612	Silvery flower (tetraploid) 3	24.041
	CNS0095613	Golden flower (tetraploid) 1	44.301
	CNS0095614	Golden flower (tetraploid) 2	49.070
	CNS0095615	Golden flower (tetraploid) 3	37.910
CRA001975	CRR073297	Stem 1	9.362
	CRR073298	Stem 2	12.466
	CRR073299	Stem 3	10.553
	CRR073300	Leaf 1	9.257
	CRR073301	Leaf 2	11.957
	CRR073302	Leaf 3	7.591
	CRR073303	Juvenile bud 1	7.243
	CRR073304	Juvenile bud 2	5.394
	CRR073305	Juvenile bud 3	6.546
	CRR073306	Third green 1	4.075
	CRR073307	Third green 2	3.343
	CRR073308	Third green 3	3.692
	CRR073309	Second white 1	10.871
	CRR073310	Second white 2	13.107
	CRR073311	Second white 3	14.235
	CRR073312	Silver flowering 1	12.298
	CRR073313	Silver flowering 2	7.333
	CRR073314	Silver flowering 3	16.058
	CRR073315	Gold flowering 1	34.903
	CRR073316	Gold flowering 2	34.707
	CRR073317	Gold flowering 3	28.643
	CRR073318	Tawny withering 1	67.396
	CRR073319	Tawny withering 2	80.505
	CRR073320	Tawny withering 3	55.518