Gene detail

Detail information of GWHGAAZE012300

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU43418.1	2.32145E-84	hypothetical protein MIMGU_mgv1a013342mg [Erythranthe guttata]
trEMBL	tr\|A0A022RUK1\|A0A022RUK1_ERYGU	9E-85	Eukaryotic translation initiation factor 3 subunit J {ECO:0000256\|HAMAP-Rule:MF_03009}
TAIR10	AT5G37475.1	1E-40	Translation initiation factor eIF3 subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	83254230	83257571	+
GWHAAZE00000003	mRNA	83254230	83257571	+
GWHAAZE00000003	exon	83254230	83254346	+
GWHAAZE00000003	exon	83255684	83255820	+
GWHAAZE00000003	exon	83257146	83257293	+
GWHAAZE00000003	exon	83257395	83257571	+
GWHAAZE00000003	CDS	83254230	83254346	+
GWHAAZE00000003	CDS	83255684	83255820	+
GWHAAZE00000003	CDS	83257146	83257293	+
GWHAAZE00000003	CDS	83257395	83257571	+

Transcript Sequence
>GWHTAAZE012314 GATGTGCCAGTGCCGCTGGTTCAAAAAAAGGAGCTGGTGAAAAGTTTATGGGATGATGAAGACGTGGATGAAAACGATGTGAAGGATTCTTGGGAGGATGACGAAGAGCCTGCTCCGGCTCCTGTGGCAGAACCTCCTGTTGAAAAGGCCCCAAAAAAGTCTGGAGCAAAAGCTAGTGATAAAAAAGGAAAAGCCGTTGAAGTAGTAGCGGAGGTTCCACTAGACCCCATAGCAGAAAAACTTCGACAGCAAAGGCTTGTGGAAGAAGCCGACTACAAAAACACTACAGAACTTTTTGGTAAAAAAGCTGACGAGAAGTCCCTTGATAATTTCATTCCTAAATCAGAAAGCGACTTCTTAGAATATGCAGAGCTCTTATGTCATAAGCTCCGTCCTTATGAGAAAAGTTTCCATTATATTGGATTGCTTAAGGATATAATGAGACTGTCAACAAATTCTCTGAAAGCTGCAGATGCAAAAGAAATTGCATCTTCAGTAACTGCCATTGCAAATGAAAAGATAAAATTAGAGAAGGAAGCTAATGCGGGTAAAAAGAAGACAGGTATGCAATTTTTTTGA

Network for GWHGAAZE012300

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08597.11	eIF3_subunit	8	187	2.10E-45

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03245	EIF3J	RNA transport	map03013

Gene Ontology

GO term	Ontology	Name
GO:0005737	cellular_component	cytoplasm
GO:0005852	cellular_component	eukaryotic translation initiation factor 3 complex
GO:0003743	molecular_function	translation initiation factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	40.709
	SRR3591706	second leaf	25.174
	SRR3591707	mature leaf	15.728
	SRR3591708	Shoot apex	29.008
	SRR3591709	Stem	19.377
	SRR3591710	White floral bud	20.192
	SRR3591711	White flower	33.921
	SRR3591712	Green floral bud	27.497
	SRR3591713	Yellow flower	27.906
SRP173429	SRR8316895	Juvenile bud stage	22.175
	SRR8316896	Juvenile bud stage	27.174
	SRR8316897	Juvenile bud stage	16.704
	SRR8316894	Third green stage	12.006
	SRR8316900	Third green stage	36.811
	SRR8316901	Third green stage	30.181
	SRR8316898	Complete white stage	16.179
	SRR8316899	Complete white stage	44.545
	SRR8316903	Complete white stage	19.822
	SRR8316902	Silver flowering stage	16.566
	SRR8316904	Silver flowering stage	21.979
	SRR8316905	Silver flowering stage	10.312
	SRR8316906	Gold flowering stage	32.166
	SRR8316907	Gold flowering stage	27.134
	SRR8316908	Gold flowering stage	34.049
SRP132670	SRR6706286	Control	32.185
	SRR6706287	Light intensity 50%	27.651
	SRR6706288	Light intensity 20%	32.807
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.088
	CNS0095593	Slightly white alabastrum(diploid) 2	20.551
	CNS0095594	Slightly white alabastrum(diploid) 3	17.347
	CNS0095595	Whole white alabastrum(diploid) 2	19.997
	CNS0095596	Whole white alabastrum(diploid) 3	16.804
	CNS0095597	Whole white alabastrum(diploid) 4	12.566
	CNS0095598	Silvery flower (diploied) 1	15.800
	CNS0095599	Silvery flower (diploied) 2	15.798
	CNS0095600	Silvery flower (diploied) 3	29.466
	CNS0095601	Golden flower (diploid) 1	13.920
	CNS0095602	Golden flower (diploid) 2	26.471
	CNS0095603	Golden flower (diploid) 3	24.142
	CNS0095604	Slightly white alabastrum(tetraploid) 1	21.416
	CNS0095605	Slightly white alabastrum(tetraploid) 2	18.684
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.685
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.580
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.396
	CNS0095609	Whole white alabastrum(tetraploid) 3	26.142
	CNS0095610	Silvery flower (tetraploid) 1	33.093
	CNS0095611	Silvery flower (tetraploid) 2	19.901
	CNS0095612	Silvery flower (tetraploid) 3	16.893
	CNS0095613	Golden flower (tetraploid) 1	12.882
	CNS0095614	Golden flower (tetraploid) 2	21.746
	CNS0095615	Golden flower (tetraploid) 3	20.005
CRA001975	CRR073297	Stem 1	21.844
	CRR073298	Stem 2	18.828
	CRR073299	Stem 3	19.851
	CRR073300	Leaf 1	25.340
	CRR073301	Leaf 2	19.798
	CRR073302	Leaf 3	29.071
	CRR073303	Juvenile bud 1	23.251
	CRR073304	Juvenile bud 2	21.673
	CRR073305	Juvenile bud 3	22.671
	CRR073306	Third green 1	9.235
	CRR073307	Third green 2	11.951
	CRR073308	Third green 3	9.386
	CRR073309	Second white 1	11.515
	CRR073310	Second white 2	9.841
	CRR073311	Second white 3	4.267
	CRR073312	Silver flowering 1	7.688
	CRR073313	Silver flowering 2	10.006
	CRR073314	Silver flowering 3	6.888
	CRR073315	Gold flowering 1	7.476
	CRR073316	Gold flowering 2	13.899
	CRR073317	Gold flowering 3	5.892
	CRR073318	Tawny withering 1	22.206
	CRR073319	Tawny withering 2	20.556
	CRR073320	Tawny withering 3	26.092