Gene detail

Detail information of GWHGAAZE012385

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004297725.1	4.67882E-91	PREDICTED: protein-S-isoprenylcysteine O-methyltransferase B-like isoform 2 [Fragaria vesca subsp. vesca]
Swissprot	tr\|Q93W54\|ICMTB_ARATH	3E-85	Protein-S-isoprenylcysteine O-methyltransferase B
trEMBL	tr\|M5XX67\|M5XX67_PRUPE	4E-91	Uncharacterized protein {ECO:0000313\|EMBL:EMJ23815.1}
TAIR10	AT5G08335.1	5E-68	Isoprenylcysteine carboxyl methyltransferase (ICMT) family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	84692107	84692652	-
GWHAAZE00000003	mRNA	84692107	84692652	-
GWHAAZE00000003	exon	84692107	84692652	-
GWHAAZE00000003	CDS	84692107	84692652	-

Transcript Sequence
>GWHTAAZE012399 ATGTTCTTTGCAGTAATATTCTTTCATGTCTCCGAATTCATTCTAGCAATCATTATTCATCGAACAAACATAACTCCCAAATCCCTATTGATTAGCAAAAACTATCTCCTGGCTATGACATTCTCGCTTCTAGAGTACTTCATTGAAAGGCATTTTTTCCACGAGTTAAAGGAGCACTGGTGGATAAGCAACTTGGGCCTAACAATGGTCATTGTTGGGGAAATTATACGCAAGTTGGCAATTCTAACTGCAGGACGGGCCTTCACTCATCTTATCAAGGTTGATTATGACCACCATCACAAATTGGTCACCCATGGAATCTATAGAGTGGTCCGTCACCCAGGATATTCCGGCTTCTTTATCTGGTCAGTTGGCACGCAAATAATGCTCTGTAATCCGGTATCCATGGTTGCGTTTATGTTTGTTGTGTGGCGCTTTTTCTCGTTTAGAATAACATACGAAGAATACTACTTGAGGCGGTTTTTTGGGTCACAGTATGATGATTATGCTCGACGGGTTTCTTCTGGGATTCCCTTTTTTAAGTGA

Network for GWHGAAZE012385

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04140.15	ICMT	67	158	9.30E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00587	ICMT, STE14	Biosynthesis of secondary metabolites	map01110
K00587	ICMT, STE14	Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0006481	biological_process	C-terminal protein methylation
GO:0016021	cellular_component	integral component of membrane
GO:0005783	cellular_component	endoplasmic reticulum
GO:0004671	molecular_function	protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	3.607
	SRR3591706	second leaf	4.148
	SRR3591707	mature leaf	4.738
	SRR3591708	Shoot apex	5.019
	SRR3591709	Stem	4.681
	SRR3591710	White floral bud	2.911
	SRR3591711	White flower	3.153
	SRR3591712	Green floral bud	10.892
	SRR3591713	Yellow flower	1.598
SRP173429	SRR8316895	Juvenile bud stage	2.511
	SRR8316896	Juvenile bud stage	4.311
	SRR8316897	Juvenile bud stage	1.797
	SRR8316894	Third green stage	3.137
	SRR8316900	Third green stage	11.673
	SRR8316901	Third green stage	9.912
	SRR8316898	Complete white stage	4.228
	SRR8316899	Complete white stage	8.246
	SRR8316903	Complete white stage	6.422
	SRR8316902	Silver flowering stage	2.575
	SRR8316904	Silver flowering stage	4.504
	SRR8316905	Silver flowering stage	1.553
	SRR8316906	Gold flowering stage	5.001
	SRR8316907	Gold flowering stage	7.127
	SRR8316908	Gold flowering stage	4.344
SRP132670	SRR6706286	Control	3.671
	SRR6706287	Light intensity 50%	4.890
	SRR6706288	Light intensity 20%	5.911
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	8.584
	CNS0095593	Slightly white alabastrum(diploid) 2	6.600
	CNS0095594	Slightly white alabastrum(diploid) 3	10.482
	CNS0095595	Whole white alabastrum(diploid) 2	13.664
	CNS0095596	Whole white alabastrum(diploid) 3	18.210
	CNS0095597	Whole white alabastrum(diploid) 4	13.857
	CNS0095598	Silvery flower (diploied) 1	4.175
	CNS0095599	Silvery flower (diploied) 2	2.772
	CNS0095600	Silvery flower (diploied) 3	9.554
	CNS0095601	Golden flower (diploid) 1	2.871
	CNS0095602	Golden flower (diploid) 2	5.748
	CNS0095603	Golden flower (diploid) 3	4.594
	CNS0095604	Slightly white alabastrum(tetraploid) 1	13.233
	CNS0095605	Slightly white alabastrum(tetraploid) 2	10.728
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.576
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.710
	CNS0095608	Whole white alabastrum(tetraploid) 2	15.545
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.542
	CNS0095610	Silvery flower (tetraploid) 1	9.741
	CNS0095611	Silvery flower (tetraploid) 2	10.222
	CNS0095612	Silvery flower (tetraploid) 3	10.021
	CNS0095613	Golden flower (tetraploid) 1	4.894
	CNS0095614	Golden flower (tetraploid) 2	6.479
	CNS0095615	Golden flower (tetraploid) 3	4.044
CRA001975	CRR073297	Stem 1	3.422
	CRR073298	Stem 2	2.356
	CRR073299	Stem 3	2.835
	CRR073300	Leaf 1	2.657
	CRR073301	Leaf 2	2.917
	CRR073302	Leaf 3	4.206
	CRR073303	Juvenile bud 1	2.998
	CRR073304	Juvenile bud 2	1.907
	CRR073305	Juvenile bud 3	1.714
	CRR073306	Third green 1	2.511
	CRR073307	Third green 2	3.319
	CRR073308	Third green 3	4.238
	CRR073309	Second white 1	3.681
	CRR073310	Second white 2	3.425
	CRR073311	Second white 3	3.440
	CRR073312	Silver flowering 1	2.825
	CRR073313	Silver flowering 2	2.905
	CRR073314	Silver flowering 3	1.468
	CRR073315	Gold flowering 1	1.180
	CRR073316	Gold flowering 2	1.659
	CRR073317	Gold flowering 3	0.698
	CRR073318	Tawny withering 1	2.107
	CRR073319	Tawny withering 2	2.298
	CRR073320	Tawny withering 3	4.380