Gene detail

Detail information of GWHGAAZE012491

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010104706.1	7.40932E-55	putative calcium-binding protein CML25 [Morus notabilis]
Swissprot	tr\|Q9FYK2\|CML25_ARATH	1E-48	Probable calcium-binding protein CML25
trEMBL	tr\|W9SF34\|W9SF34_9ROSA	3E-55	Putative calcium-binding protein CML25 {ECO:0000313\|EMBL:EXC48677.1}
TAIR10	AT1G24620.1	2E-39	EF hand calcium-binding protein family

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	86477197	86477568	+
GWHAAZE00000003	mRNA	86477197	86477568	+
GWHAAZE00000003	exon	86477197	86477568	+
GWHAAZE00000003	CDS	86477197	86477568	+

Transcript Sequence
>GWHTAAZE012505 ATGTCCTCCCTCGGCCACTCCACCACCGACGGGGAGCTCGTCAACATGATCAAGGAGGTCGATAGTGATGGCGATGGATTCATCGATTTGAACGAGTTCATCGAGCTCAATACGAAGGGCGTTGATTCCGAGGAGTTGTTGGAGAATTTGAAACACGCGTTTGATGTGTTTGATGTTGATAAGAACGGAGTTATTTCGGCGGAGGAGTTGATGAATGTGTTGGTGAGTTTGGGGGAGGAGTGTGATATTGAGGAGTGTAGGAAGATGATTGGTGGTGTTGATTCTGATGGGGACGGGACTATTAGTTTCGAAGAATTCAAGGTTATGATGACAAATGGTTCTCGTTTTGATTCCATTGGTGCTTCGAATTGA

Network for GWHGAAZE012491

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00036.33	EF-hand_1	12	36	4.80E-07
PF13499.7	EF-hand_7	48	110	3.00E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	12.540
	SRR3591706	second leaf	9.871
	SRR3591707	mature leaf	6.373
	SRR3591708	Shoot apex	15.989
	SRR3591709	Stem	9.683
	SRR3591710	White floral bud	68.374
	SRR3591711	White flower	21.847
	SRR3591712	Green floral bud	33.303
	SRR3591713	Yellow flower	17.816
SRP173429	SRR8316895	Juvenile bud stage	12.018
	SRR8316896	Juvenile bud stage	19.573
	SRR8316897	Juvenile bud stage	11.730
	SRR8316894	Third green stage	6.477
	SRR8316900	Third green stage	16.637
	SRR8316901	Third green stage	19.793
	SRR8316898	Complete white stage	10.309
	SRR8316899	Complete white stage	22.403
	SRR8316903	Complete white stage	12.779
	SRR8316902	Silver flowering stage	6.136
	SRR8316904	Silver flowering stage	5.265
	SRR8316905	Silver flowering stage	2.658
	SRR8316906	Gold flowering stage	12.110
	SRR8316907	Gold flowering stage	7.439
	SRR8316908	Gold flowering stage	4.850
SRP132670	SRR6706286	Control	12.972
	SRR6706287	Light intensity 50%	14.511
	SRR6706288	Light intensity 20%	12.251
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.510
	CNS0095593	Slightly white alabastrum(diploid) 2	19.492
	CNS0095594	Slightly white alabastrum(diploid) 3	24.642
	CNS0095595	Whole white alabastrum(diploid) 2	15.392
	CNS0095596	Whole white alabastrum(diploid) 3	16.137
	CNS0095597	Whole white alabastrum(diploid) 4	19.981
	CNS0095598	Silvery flower (diploied) 1	15.695
	CNS0095599	Silvery flower (diploied) 2	17.811
	CNS0095600	Silvery flower (diploied) 3	15.180
	CNS0095601	Golden flower (diploid) 1	14.501
	CNS0095602	Golden flower (diploid) 2	12.663
	CNS0095603	Golden flower (diploid) 3	13.174
	CNS0095604	Slightly white alabastrum(tetraploid) 1	11.912
	CNS0095605	Slightly white alabastrum(tetraploid) 2	12.897
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.804
	CNS0095607	Whole white alabastrum(tetraploid) 1	9.271
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.313
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.643
	CNS0095610	Silvery flower (tetraploid) 1	7.566
	CNS0095611	Silvery flower (tetraploid) 2	9.576
	CNS0095612	Silvery flower (tetraploid) 3	15.374
	CNS0095613	Golden flower (tetraploid) 1	6.064
	CNS0095614	Golden flower (tetraploid) 2	7.306
	CNS0095615	Golden flower (tetraploid) 3	6.110
CRA001975	CRR073297	Stem 1	15.564
	CRR073298	Stem 2	13.521
	CRR073299	Stem 3	15.207
	CRR073300	Leaf 1	19.184
	CRR073301	Leaf 2	22.526
	CRR073302	Leaf 3	18.856
	CRR073303	Juvenile bud 1	24.690
	CRR073304	Juvenile bud 2	51.258
	CRR073305	Juvenile bud 3	24.471
	CRR073306	Third green 1	73.621
	CRR073307	Third green 2	63.419
	CRR073308	Third green 3	52.828
	CRR073309	Second white 1	29.753
	CRR073310	Second white 2	15.945
	CRR073311	Second white 3	20.723
	CRR073312	Silver flowering 1	34.547
	CRR073313	Silver flowering 2	43.988
	CRR073314	Silver flowering 3	26.249
	CRR073315	Gold flowering 1	33.203
	CRR073316	Gold flowering 2	29.043
	CRR073317	Gold flowering 3	32.895
	CRR073318	Tawny withering 1	17.508
	CRR073319	Tawny withering 2	14.292
	CRR073320	Tawny withering 3	19.406