Gene detail

Detail information of GWHGAAZE012500

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006469224.1	3.70081E-51	PREDICTED: dynein light chain LC6, flagellar outer arm-like isoform X2 [Citrus sinensis]
Swissprot	tr\|Q39580\|DYL1_CHLRE	2E-16	Dynein 8 kDa light chain, flagellar outer arm
trEMBL	tr\|A0A067FB59\|A0A067FB59_CITSI	1E-51	Uncharacterized protein {ECO:0000313\|EMBL:KDO64568.1}
TAIR10	AT1G23220.1	1E-33	Dynein light chain type 1 family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	86589213	86591522	-
GWHAAZE00000003	mRNA	86589213	86591522	-
GWHAAZE00000003	exon	86591415	86591522	-
GWHAAZE00000003	exon	86589213	86589368	-
GWHAAZE00000003	CDS	86591415	86591522	-
GWHAAZE00000003	CDS	86589213	86589368	-

Transcript Sequence
>GWHTAAZE012514 ATGCCCTTGGCTTTGCAAAATCGCGCTTTTAAATGCGCCAGGGACAATATCGACTCCATTATGCCTTCAAAGCTCGATAGCAAACGCCTCGCCCTTGCCCTCAAGAAGGAATTTGATGCATCATATGGTCCAGCTTGGCACTGCGTCGTGGGGACCAGCTTTGGCTCTTATGTCACACATTCCGTAGGAGGTTTTTTGTACTTTTCAATTGACAAGGTTTATGTCCTCCTTTTCAAAACTACTGTTGAGCCTTTGGATCATTGA

Network for GWHGAAZE012500

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01221.19	Dynein_light	1	80	9.70E-28

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10418	DYNLL	Vasopressin-regulated water reabsorption	map04962

Gene Ontology

GO term	Ontology	Name
GO:0007017	biological_process	microtubule-based process
GO:0030286	cellular_component	dynein complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.586
	SRR3591706	second leaf	7.470
	SRR3591707	mature leaf	2.450
	SRR3591708	Shoot apex	37.004
	SRR3591709	Stem	25.730
	SRR3591710	White floral bud	4.743
	SRR3591711	White flower	9.185
	SRR3591712	Green floral bud	7.234
	SRR3591713	Yellow flower	5.087
SRP173429	SRR8316895	Juvenile bud stage	16.329
	SRR8316896	Juvenile bud stage	15.266
	SRR8316897	Juvenile bud stage	7.643
	SRR8316894	Third green stage	5.622
	SRR8316900	Third green stage	8.771
	SRR8316901	Third green stage	7.981
	SRR8316898	Complete white stage	1.112
	SRR8316899	Complete white stage	7.628
	SRR8316903	Complete white stage	0.666
	SRR8316902	Silver flowering stage	0.272
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.130
	SRR8316906	Gold flowering stage	1.277
	SRR8316907	Gold flowering stage	2.604
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	4.086
	SRR6706287	Light intensity 50%	4.928
	SRR6706288	Light intensity 20%	4.583
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.643
	CNS0095593	Slightly white alabastrum(diploid) 2	14.073
	CNS0095594	Slightly white alabastrum(diploid) 3	15.475
	CNS0095595	Whole white alabastrum(diploid) 2	7.760
	CNS0095596	Whole white alabastrum(diploid) 3	4.447
	CNS0095597	Whole white alabastrum(diploid) 4	4.880
	CNS0095598	Silvery flower (diploied) 1	15.369
	CNS0095599	Silvery flower (diploied) 2	10.616
	CNS0095600	Silvery flower (diploied) 3	4.814
	CNS0095601	Golden flower (diploid) 1	8.674
	CNS0095602	Golden flower (diploid) 2	5.559
	CNS0095603	Golden flower (diploid) 3	7.922
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.922
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.408
	CNS0095606	Slightly white alabastrum(tetraploid) 3	22.578
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.288
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.342
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.701
	CNS0095610	Silvery flower (tetraploid) 1	0.856
	CNS0095611	Silvery flower (tetraploid) 2	4.292
	CNS0095612	Silvery flower (tetraploid) 3	1.463
	CNS0095613	Golden flower (tetraploid) 1	1.497
	CNS0095614	Golden flower (tetraploid) 2	1.501
	CNS0095615	Golden flower (tetraploid) 3	0.959
CRA001975	CRR073297	Stem 1	11.321
	CRR073298	Stem 2	16.024
	CRR073299	Stem 3	14.586
	CRR073300	Leaf 1	5.835
	CRR073301	Leaf 2	11.156
	CRR073302	Leaf 3	7.043
	CRR073303	Juvenile bud 1	3.531
	CRR073304	Juvenile bud 2	3.348
	CRR073305	Juvenile bud 3	3.543
	CRR073306	Third green 1	0.565
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.553
	CRR073310	Second white 2	0.101
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.104
	CRR073316	Gold flowering 2	2.599
	CRR073317	Gold flowering 3	2.139
	CRR073318	Tawny withering 1	35.339
	CRR073319	Tawny withering 2	29.774
	CRR073320	Tawny withering 3	41.248