Gene detail

Detail information of GWHGAAZE012528

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010657445.1	2.08469E-81	PREDICTED: homeobox-leucine zipper protein HOX3 [Vitis vinifera]
Swissprot	tr\|Q8S9N6\|ATB17_ARATH	1E-66	Homeobox-leucine zipper protein ATHB-17
trEMBL	tr\|D7T8T6\|D7T8T6_VITVI	8E-82	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI26907.3}
TAIR10	AT2G01430.1	9E-44	homeobox-leucine zipper protein 17

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	87231318	87233761	+
GWHAAZE00000003	mRNA	87231318	87233761	+
GWHAAZE00000003	exon	87231318	87231399	+
GWHAAZE00000003	exon	87231575	87231783	+
GWHAAZE00000003	exon	87232108	87232187	+
GWHAAZE00000003	exon	87233467	87233761	+
GWHAAZE00000003	CDS	87231318	87231399	+
GWHAAZE00000003	CDS	87231575	87231783	+
GWHAAZE00000003	CDS	87232108	87232187	+
GWHAAZE00000003	CDS	87233467	87233761	+

Transcript Sequence
>GWHTAAZE012542 ATGGCGATTTTACCTCCATGTTTGGAGCTAACCATATCTCTACCTGGCTTCACTTCTTCACCATCTCTTCCTTCCTCTGCTGGAGAAAACGAAGGTGATCAAAGCCGAAGAGGTGGTGGAATGAGAGATTTGGACATAAATCAACTACCCTGCTTAACAGAAGAAGAAGAAGACGAAGAAGAAGAAGAAGAAGAGAGGAGGTCATCGGTTCCCCGTAAGAAACTCCGACTCACCAAAGAACAGTCTCTTCTCCTTGAAGAAAGCTTCAGACAAAACCACACCTTGAGCTCTAAACAGAAGGAGGGATTAGCTAAGAAATTGGAGTTAAAGGCAAGGCAAGTTGAAGTGTGGTTTCAAAACCGTAGAGCAAGGACGAGGCTGAAACAAACGGAGATGGAATGTGAGTACTTGAAGAGATGGTTTGGGTCACTGACCGAAGAAAACCGGAAGCTACAAAAGGAGGTTGAACAACTTAGGGCCAAGAAGTCAGGACTGCCCACCATTGTGCCGCCACACAGCCCGGCATCATCAACCCTAAGCATGTGCCCTCAGTGCAAGCGTGTCACCACCACAACCACCACCATCACTACCACCCCGGCCAAGCCGATCAACTTGTCTCCAAAAATTCCTATTTGTCAGTCCCGACATTCATCATCAACTTGTTAG

Network for GWHGAAZE012528

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00046.30	Homeodomain	72	126	7.60E-17
PF02183.19	HALZ	128	162	4.30E-10

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	HB-HD-ZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding
GO:0043565	molecular_function	sequence-specific DNA binding
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.110
	SRR3591707	mature leaf	0.259
	SRR3591708	Shoot apex	0.337
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.485
	SRR3591711	White flower	1.024
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.513
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.072
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.118
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.860
	SRR8316907	Gold flowering stage	0.196
	SRR8316908	Gold flowering stage	0.534
SRP132670	SRR6706286	Control	0.076
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.172
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.219
	CNS0095595	Whole white alabastrum(diploid) 2	0.027
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.058
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.111
	CNS0095600	Silvery flower (diploied) 3	0.498
	CNS0095601	Golden flower (diploid) 1	0.401
	CNS0095602	Golden flower (diploid) 2	0.083
	CNS0095603	Golden flower (diploid) 3	0.817
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.202
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.371
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.033
	CNS0095614	Golden flower (tetraploid) 2	1.061
	CNS0095615	Golden flower (tetraploid) 3	0.095
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.003
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.101
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.118
	CRR073307	Third green 2	0.223
	CRR073308	Third green 3	0.058
	CRR073309	Second white 1	0.888
	CRR073310	Second white 2	1.469
	CRR073311	Second white 3	0.309
	CRR073312	Silver flowering 1	1.048
	CRR073313	Silver flowering 2	1.086
	CRR073314	Silver flowering 3	0.883
	CRR073315	Gold flowering 1	0.083
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.737
	CRR073318	Tawny withering 1	0.817
	CRR073319	Tawny withering 2	0.627
	CRR073320	Tawny withering 3	0.045