Gene detail

Detail information of GWHGAAZE012574

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009630445.1	2.15532E-39	PREDICTED: E3 ubiquitin-protein ligase MBR1-like [Nicotiana tomentosiformis]
Swissprot	tr\|Q7XTV7\|HIP1_ORYSJ	1E-22	Probable E3 ubiquitin-protein ligase HIP1
trEMBL	tr\|A0A068TWK2\|A0A068TWK2_COFCA	4E-38	Coffea canephora DH200=94 genomic scaffold, scaffold_5 {ECO:0000313\|EMBL:CDP00670.1}
TAIR10	AT1G17970.1	1E-24	RING/U-box superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	87992383	87993654	-
GWHAAZE00000003	mRNA	87992383	87993654	-
GWHAAZE00000003	exon	87992383	87992523	-
GWHAAZE00000003	exon	87993026	87993181	-
GWHAAZE00000003	exon	87993253	87993337	-
GWHAAZE00000003	exon	87993593	87993654	-
GWHAAZE00000003	CDS	87993593	87993654	-
GWHAAZE00000003	CDS	87993253	87993337	-
GWHAAZE00000003	CDS	87993026	87993181	-
GWHAAZE00000003	CDS	87992383	87992523	-

Transcript Sequence
>GWHTAAZE012588 ATGTCTCTGACGATAGGCAATTTCGCCGCTTTAGGCGTTCCTCTCGTGGAGGACTCCCAGAGCAATGATCAGTTTGGGGACTGGAGACTCAATGTTGATACCATGTCATATGAGGTGTTTATATACAAGTTCCTTACTTCTGTGACTGAACTGCTTGATCTAAGTGATAGGATTGGGTATGTCGGCACAGGGTTACAAGAAGACGAGATAATGCTGTGTCTGGTGAAAACTACGAGCTTAAATTCAGAATCGCTTCCATTGTTAACTTCGAGTGGCAAAGACTGGACGTGTAGCATTTGCCAAGGCGGGTGCAAGGAAGATGAGGAGCTGGGAAGACTGGACTGCGGACATTACCATCATATAAACTGCATAAAGCAATGGCTTCGGTACAAGAACGCTTGCCCCATTTGCAAAACTGAAGCAGTGGTTGATAAGCTTGGTTGA

Network for GWHGAAZE012574

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0166

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13639.7	zf-RING_2	96	138	1.10E-09

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	RING
Ubiquitin Family	U-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.575
	SRR3591706	second leaf	7.111
	SRR3591707	mature leaf	3.947
	SRR3591708	Shoot apex	15.167
	SRR3591709	Stem	14.195
	SRR3591710	White floral bud	1.991
	SRR3591711	White flower	4.612
	SRR3591712	Green floral bud	6.642
	SRR3591713	Yellow flower	0.473
SRP173429	SRR8316895	Juvenile bud stage	6.822
	SRR8316896	Juvenile bud stage	7.790
	SRR8316897	Juvenile bud stage	2.759
	SRR8316894	Third green stage	2.040
	SRR8316900	Third green stage	5.488
	SRR8316901	Third green stage	5.275
	SRR8316898	Complete white stage	0.509
	SRR8316899	Complete white stage	4.486
	SRR8316903	Complete white stage	1.280
	SRR8316902	Silver flowering stage	0.464
	SRR8316904	Silver flowering stage	0.483
	SRR8316905	Silver flowering stage	0.340
	SRR8316906	Gold flowering stage	0.608
	SRR8316907	Gold flowering stage	0.931
	SRR8316908	Gold flowering stage	0.869
SRP132670	SRR6706286	Control	2.298
	SRR6706287	Light intensity 50%	3.409
	SRR6706288	Light intensity 20%	3.206
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.415
	CNS0095593	Slightly white alabastrum(diploid) 2	14.435
	CNS0095594	Slightly white alabastrum(diploid) 3	10.044
	CNS0095595	Whole white alabastrum(diploid) 2	7.064
	CNS0095596	Whole white alabastrum(diploid) 3	5.725
	CNS0095597	Whole white alabastrum(diploid) 4	6.516
	CNS0095598	Silvery flower (diploied) 1	13.337
	CNS0095599	Silvery flower (diploied) 2	13.927
	CNS0095600	Silvery flower (diploied) 3	2.269
	CNS0095601	Golden flower (diploid) 1	9.405
	CNS0095602	Golden flower (diploid) 2	4.259
	CNS0095603	Golden flower (diploid) 3	2.948
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.687
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.331
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.233
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.766
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.391
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.327
	CNS0095610	Silvery flower (tetraploid) 1	1.334
	CNS0095611	Silvery flower (tetraploid) 2	1.218
	CNS0095612	Silvery flower (tetraploid) 3	0.786
	CNS0095613	Golden flower (tetraploid) 1	0.813
	CNS0095614	Golden flower (tetraploid) 2	0.745
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	10.096
	CRR073298	Stem 2	9.840
	CRR073299	Stem 3	9.566
	CRR073300	Leaf 1	5.275
	CRR073301	Leaf 2	6.500
	CRR073302	Leaf 3	5.348
	CRR073303	Juvenile bud 1	6.254
	CRR073304	Juvenile bud 2	2.098
	CRR073305	Juvenile bud 3	5.277
	CRR073306	Third green 1	1.436
	CRR073307	Third green 2	0.768
	CRR073308	Third green 3	1.484
	CRR073309	Second white 1	0.180
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.156
	CRR073314	Silver flowering 3	0.119
	CRR073315	Gold flowering 1	1.121
	CRR073316	Gold flowering 2	2.878
	CRR073317	Gold flowering 3	2.685
	CRR073318	Tawny withering 1	11.006
	CRR073319	Tawny withering 2	8.669
	CRR073320	Tawny withering 3	9.817