Gene detail

Detail information of GWHGAAZE012617

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009791827.1	6.27523E-68	PREDICTED: inositol-tetrakisphosphate 1-kinase 1-like [Nicotiana sylvestris]
Swissprot	tr\|Q9SBA5\|ITPK1_ARATH	4E-54	Inositol-tetrakisphosphate 1-kinase 1
trEMBL	tr\|M1DBD5\|M1DBD5_SOLTU	3E-63	Inositol-tetrakisphosphate 1-kinase {ECO:0000256\|PIRNR:PIRNR038186}
TAIR10	AT5G16760.1	5E-45	Inositol 1,3,4-trisphosphate 5/6-kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	88587115	88587582	+
GWHAAZE00000003	mRNA	88587115	88587582	+
GWHAAZE00000003	exon	88587115	88587582	+
GWHAAZE00000003	CDS	88587115	88587582	+

Transcript Sequence
>GWHTAAZE012631 TGGCTTAAAGGAGCTAGAACCGCCTATTGTTTTGCAAGAGTTTGTGAATCACGGGGAGTTATATTTAAAGTGTATGTAGCTGGTAACCACATAAAATGTGTCAAGAGGAGGTCGTTGCCAGATATATCTGAGGAGAAATTGGGGATATCAGGGGGTATATTGTCTTTTTCGCAGATATCCAACTTGGCAAGTGAAGATGCGAGTGGTGATAGTTATGCAAAGGTTATTGAAGAGGCAAAAATGCCGTCTTTGAGTTTTGTTTCTGAGGTAGCTAATGGGTTGAGGGAGGCTTTGAAGCTTCATCTGTTTAACTTCGATATGATTAGGGATAATAGAGATGGGACCCGGTATCTGGTCATTGATATCAATTACTTTCCTGGGTATGCCAAGATGCCCTCATACGAGACTATTTTGACTGATTTCTTTCTGGATATTGCTCATCAGACTCAAAGTGAGAATTCTGATTGA

Network for GWHGAAZE012617

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05770.12	Ins134_P3_kin	18	144	4.00E-50

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00913	ITPK1	Metabolic pathways	map01100
		Inositol phosphate metabolism	map00562
		Phosphatidylinositol signaling system	map04070

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	58.164
	SRR3591706	second leaf	14.608
	SRR3591707	mature leaf	12.991
	SRR3591708	Shoot apex	20.321
	SRR3591709	Stem	45.213
	SRR3591710	White floral bud	11.458
	SRR3591711	White flower	16.169
	SRR3591712	Green floral bud	25.876
	SRR3591713	Yellow flower	6.561
SRP173429	SRR8316895	Juvenile bud stage	21.905
	SRR8316896	Juvenile bud stage	36.726
	SRR8316897	Juvenile bud stage	18.391
	SRR8316894	Third green stage	10.546
	SRR8316900	Third green stage	27.717
	SRR8316901	Third green stage	28.434
	SRR8316898	Complete white stage	7.914
	SRR8316899	Complete white stage	26.741
	SRR8316903	Complete white stage	13.727
	SRR8316902	Silver flowering stage	13.898
	SRR8316904	Silver flowering stage	12.850
	SRR8316905	Silver flowering stage	5.758
	SRR8316906	Gold flowering stage	14.385
	SRR8316907	Gold flowering stage	14.538
	SRR8316908	Gold flowering stage	12.710
SRP132670	SRR6706286	Control	10.124
	SRR6706287	Light intensity 50%	10.094
	SRR6706288	Light intensity 20%	9.977
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	38.093
	CNS0095593	Slightly white alabastrum(diploid) 2	40.180
	CNS0095594	Slightly white alabastrum(diploid) 3	28.903
	CNS0095595	Whole white alabastrum(diploid) 2	31.793
	CNS0095596	Whole white alabastrum(diploid) 3	23.578
	CNS0095597	Whole white alabastrum(diploid) 4	22.292
	CNS0095598	Silvery flower (diploied) 1	37.349
	CNS0095599	Silvery flower (diploied) 2	32.550
	CNS0095600	Silvery flower (diploied) 3	19.310
	CNS0095601	Golden flower (diploid) 1	19.771
	CNS0095602	Golden flower (diploid) 2	13.830
	CNS0095603	Golden flower (diploid) 3	11.003
	CNS0095604	Slightly white alabastrum(tetraploid) 1	33.526
	CNS0095605	Slightly white alabastrum(tetraploid) 2	35.443
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.633
	CNS0095607	Whole white alabastrum(tetraploid) 1	32.583
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.542
	CNS0095609	Whole white alabastrum(tetraploid) 3	32.640
	CNS0095610	Silvery flower (tetraploid) 1	20.427
	CNS0095611	Silvery flower (tetraploid) 2	17.634
	CNS0095612	Silvery flower (tetraploid) 3	15.969
	CNS0095613	Golden flower (tetraploid) 1	15.101
	CNS0095614	Golden flower (tetraploid) 2	13.261
	CNS0095615	Golden flower (tetraploid) 3	6.535
CRA001975	CRR073297	Stem 1	11.031
	CRR073298	Stem 2	8.723
	CRR073299	Stem 3	7.252
	CRR073300	Leaf 1	6.708
	CRR073301	Leaf 2	6.828
	CRR073302	Leaf 3	8.106
	CRR073303	Juvenile bud 1	6.430
	CRR073304	Juvenile bud 2	6.259
	CRR073305	Juvenile bud 3	8.398
	CRR073306	Third green 1	4.285
	CRR073307	Third green 2	4.986
	CRR073308	Third green 3	3.487
	CRR073309	Second white 1	6.795
	CRR073310	Second white 2	3.604
	CRR073311	Second white 3	2.412
	CRR073312	Silver flowering 1	2.201
	CRR073313	Silver flowering 2	1.441
	CRR073314	Silver flowering 3	2.559
	CRR073315	Gold flowering 1	9.753
	CRR073316	Gold flowering 2	8.895
	CRR073317	Gold flowering 3	7.665
	CRR073318	Tawny withering 1	26.202
	CRR073319	Tawny withering 2	36.395
	CRR073320	Tawny withering 3	38.582