Gene detail

Detail information of GWHGAAZE012618

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI26489.3	1.90597E-80	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O22212\|PRP4L_ARATH	0.00000005	U4/U6 small nuclear ribonucleoprotein PRP4-like protein
trEMBL	tr\|A0A068UYA8\|A0A068UYA8_COFCA	9E-81	Coffea canephora DH200=94 genomic scaffold, scaffold_75 {ECO:0000313\|EMBL:CDP13411.1}
TAIR10	AT5G16750.1	3E-58	Transducin family protein / WD-40 repeat family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	88592444	88594041	-
GWHAAZE00000003	mRNA	88592444	88594041	-
GWHAAZE00000003	exon	88592444	88592587	-
GWHAAZE00000003	exon	88593385	88593504	-
GWHAAZE00000003	exon	88593640	88593716	-
GWHAAZE00000003	exon	88593900	88594041	-
GWHAAZE00000003	CDS	88593900	88594041	-
GWHAAZE00000003	CDS	88593640	88593716	-
GWHAAZE00000003	CDS	88593385	88593504	-
GWHAAZE00000003	CDS	88592444	88592587	-

Transcript Sequence
>GWHTAAZE012632 ATGGCGGCTTCCAGGTCTAGTCTCCGTATTGTTCTTAAAGGGCACAAGAGGGGGATTTGGTCTGTAGAGTTTTCTCCGGTTGATCAATGTGTTACAACAGCATCCGGAGATAAGACCATAAAGATATGGGCTATATCTGATGGTGCTGATGGTTTGGTAAAGTTATGGACAGTAAATACCAACGAGTGTATTGCAACATATGATCAGCATGAGGACAAGGTTTGGGCCTTAGCCATTGGAAAGAAGACAGAAATGCTTGCAACTGGTGGCAGTGATGCTGTTATTAATTTGTGGCATGACTCTACTGTTGCTGAGAAAGAAGAAGCTCTTCGTAAAGAAGAGGAAGGTGTTTTAAAAGGGCAAGAGCTAGAAAATGCTATATCAGATGCAGAGTATTCTAAAGCAATCCCATTTGCATTTGAGCTTCGTAGGCCTCATAAACTTTTTGAGTTATTTACTCAACTTTGCAGGCAAGAATTATAA

Network for GWHGAAZE012618

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00400.33	WD40	10	43	5.50E-06
PF00400.33	WD40	62	98	0.011
PF08625.12	Utp13	121	158	5.50E-08

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	DWD

KEGG pathway

KO	Enzyme	pathway	mapID
K14555	UTP13, TBL3	Ribosome biogenesis in eukaryotes	map03008

Gene Ontology

GO term	Ontology	Name
GO:0006364	biological_process	rRNA processing
GO:0032040	cellular_component	small-subunit processome
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.319
	SRR3591706	second leaf	0.524
	SRR3591707	mature leaf	0.634
	SRR3591708	Shoot apex	1.077
	SRR3591709	Stem	0.434
	SRR3591710	White floral bud	0.496
	SRR3591711	White flower	0.675
	SRR3591712	Green floral bud	0.527
	SRR3591713	Yellow flower	0.129
SRP173429	SRR8316895	Juvenile bud stage	0.154
	SRR8316896	Juvenile bud stage	0.016
	SRR8316897	Juvenile bud stage	0.252
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.018
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.040
	SRR8316903	Complete white stage	0.077
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.105
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.012
	SRR6706288	Light intensity 20%	0.024
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.230
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.204
	CNS0095599	Silvery flower (diploied) 2	0.392
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.314
	CNS0095602	Golden flower (diploid) 2	0.139
	CNS0095603	Golden flower (diploid) 3	0.134
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.414
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.230
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.230
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.054
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.049
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.113
	CNS0095610	Silvery flower (tetraploid) 1	0.184
	CNS0095611	Silvery flower (tetraploid) 2	0.093
	CNS0095612	Silvery flower (tetraploid) 3	0.073
	CNS0095613	Golden flower (tetraploid) 1	0.167
	CNS0095614	Golden flower (tetraploid) 2	0.089
	CNS0095615	Golden flower (tetraploid) 3	0.051
CRA001975	CRR073297	Stem 1	0.519
	CRR073298	Stem 2	0.306
	CRR073299	Stem 3	0.028
	CRR073300	Leaf 1	0.179
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.037
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000