Gene detail

Detail information of GWHGAAZE012620

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP04925.1	1.9003E-114	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9M8T9\|MCC1_ARATH	5E-89	Histone acetyltransferase MCC1
trEMBL	tr\|A0A068U8Q1\|A0A068U8Q1_COFCA	7E-115	Coffea canephora DH200=94 genomic scaffold, scaffold_15 {ECO:0000313\|EMBL:CDP04925.1}
TAIR10	AT5G16800.2	6E-77	Acyl-CoA N-acyltransferases (NAT) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	88624372	88625516	-
GWHAAZE00000003	mRNA	88624372	88625516	-
GWHAAZE00000003	exon	88624372	88624604	-
GWHAAZE00000003	exon	88624690	88624789	-
GWHAAZE00000003	exon	88625160	88625304	-
GWHAAZE00000003	exon	88625410	88625516	-
GWHAAZE00000003	CDS	88625410	88625516	-
GWHAAZE00000003	CDS	88625160	88625304	-
GWHAAZE00000003	CDS	88624690	88624789	-
GWHAAZE00000003	CDS	88624372	88624604	-

Transcript Sequence
>GWHTAAZE012634 ATGGTAGACCTGAGAGGGCCCCACCGTCCAACAATATCTTATAGGCCCATTGGACCCTCTGATTTAGAAGTTCTTGAGAAAATCCACTGTGAACTATTTCCAATCAGGTACGAGCCTGAGTTCTTCCACAATGTTGTTAATGGCCGTAATATCGTGTCTTGGGGGGTTGTTGACCGTAGCCGGCCCAATGGTCAAAGTGATGAACTAATTGGATTTGTCACCACTCGTCTTGTTCAAGCAAAAGAATGTGAGATAGATGATTTGCTCAGATTTGACACATCGAGATCAGATCATACACTAGTTTATATATTAACGCTGGGAGTGGTAGAATCTTATAGAAATTTTGGCATAGCTACAACACTAATTCAAGAGGTCATCAACTATGCCTCAAATATTCGTACTTGCCGAGCTGTTTACCTACATGTGATTTCCTACAATAATCCTGCAATTTATCTGTACAAGAAAATGTCCTTCCAGTGTGTGAGAAGATTGCACTCTTTTTATTTCATCAATGGCCATCATTATGATTCATATTTGTTCATTTACTACATAAACGGTGGCCGGTCTCCTTGCTCACCACTGTAA

Network for GWHGAAZE012620

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00583.26	Acetyltransf_1	58	158	6.40E-12

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GNAT

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008080	molecular_function	N-acetyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	59.249
	SRR3591706	second leaf	26.592
	SRR3591707	mature leaf	31.892
	SRR3591708	Shoot apex	34.763
	SRR3591709	Stem	79.713
	SRR3591710	White floral bud	52.640
	SRR3591711	White flower	58.134
	SRR3591712	Green floral bud	61.266
	SRR3591713	Yellow flower	79.308
SRP173429	SRR8316895	Juvenile bud stage	23.092
	SRR8316896	Juvenile bud stage	30.723
	SRR8316897	Juvenile bud stage	17.453
	SRR8316894	Third green stage	12.958
	SRR8316900	Third green stage	47.642
	SRR8316901	Third green stage	36.533
	SRR8316898	Complete white stage	17.662
	SRR8316899	Complete white stage	55.269
	SRR8316903	Complete white stage	27.375
	SRR8316902	Silver flowering stage	17.757
	SRR8316904	Silver flowering stage	26.326
	SRR8316905	Silver flowering stage	13.402
	SRR8316906	Gold flowering stage	56.869
	SRR8316907	Gold flowering stage	51.561
	SRR8316908	Gold flowering stage	62.218
SRP132670	SRR6706286	Control	40.089
	SRR6706287	Light intensity 50%	36.095
	SRR6706288	Light intensity 20%	39.136
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	33.823
	CNS0095593	Slightly white alabastrum(diploid) 2	33.806
	CNS0095594	Slightly white alabastrum(diploid) 3	32.752
	CNS0095595	Whole white alabastrum(diploid) 2	56.420
	CNS0095596	Whole white alabastrum(diploid) 3	55.218
	CNS0095597	Whole white alabastrum(diploid) 4	62.601
	CNS0095598	Silvery flower (diploied) 1	35.574
	CNS0095599	Silvery flower (diploied) 2	28.259
	CNS0095600	Silvery flower (diploied) 3	56.423
	CNS0095601	Golden flower (diploid) 1	30.902
	CNS0095602	Golden flower (diploid) 2	65.550
	CNS0095603	Golden flower (diploid) 3	61.432
	CNS0095604	Slightly white alabastrum(tetraploid) 1	49.298
	CNS0095605	Slightly white alabastrum(tetraploid) 2	51.337
	CNS0095606	Slightly white alabastrum(tetraploid) 3	49.098
	CNS0095607	Whole white alabastrum(tetraploid) 1	75.255
	CNS0095608	Whole white alabastrum(tetraploid) 2	81.862
	CNS0095609	Whole white alabastrum(tetraploid) 3	53.956
	CNS0095610	Silvery flower (tetraploid) 1	50.752
	CNS0095611	Silvery flower (tetraploid) 2	56.154
	CNS0095612	Silvery flower (tetraploid) 3	42.949
	CNS0095613	Golden flower (tetraploid) 1	42.427
	CNS0095614	Golden flower (tetraploid) 2	49.574
	CNS0095615	Golden flower (tetraploid) 3	56.469
CRA001975	CRR073297	Stem 1	21.558
	CRR073298	Stem 2	19.145
	CRR073299	Stem 3	20.221
	CRR073300	Leaf 1	27.412
	CRR073301	Leaf 2	22.089
	CRR073302	Leaf 3	17.783
	CRR073303	Juvenile bud 1	23.610
	CRR073304	Juvenile bud 2	20.808
	CRR073305	Juvenile bud 3	13.251
	CRR073306	Third green 1	13.363
	CRR073307	Third green 2	16.891
	CRR073308	Third green 3	12.129
	CRR073309	Second white 1	15.959
	CRR073310	Second white 2	20.495
	CRR073311	Second white 3	16.995
	CRR073312	Silver flowering 1	16.809
	CRR073313	Silver flowering 2	9.927
	CRR073314	Silver flowering 3	9.994
	CRR073315	Gold flowering 1	10.970
	CRR073316	Gold flowering 2	12.673
	CRR073317	Gold flowering 3	9.836
	CRR073318	Tawny withering 1	35.546
	CRR073319	Tawny withering 2	27.201
	CRR073320	Tawny withering 3	28.155