Gene detail

Detail information of GWHGAAZE012638

Functional Annotation

Database	Orthologs	E value	Annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	88931058	88931591	-
GWHAAZE00000003	mRNA	88931058	88931591	-
GWHAAZE00000003	exon	88931058	88931591	-
GWHAAZE00000003	CDS	88931058	88931591	-

Transcript Sequence
>GWHTAAZE012652 ATGGAGGAGGTTCGAGGAAATTTGGATAGCCCTTTGGATCAGAAAATAACCTATACCATTCCACAGAATAGTGCTGCAGCGGTGCGGCCAGTGTTGATTAGATCCGTATATGCTCCGACTGACGAGGAGATAATAAGTAATATTTTGAATTTGAAGGTGAGGGGTGAAGCATTAGCGCCTTGTGATTCAGGTTTCGTCAAGGAGATTGATAGCCATGATCTTTACGGTGGAGGCAAAAAGCCCTTTGATATATTCTCCATGTGTGCTGAAGATCCAGAAAGAGACCGATCCGCTCACTTGCTCACCACTCCTCCTCCTCCTCCTAGTAGCATCAGCGAAAACGGTGACATTGGTGCCTGGAAAGTTTTTCTGGATTATCATGAACCTGTGGAGGATTGTCGTCTTGGAAATCTACTTGTTGGATCTAAGAAAACCTTTATCTACGATGACGACGGCAGCTCTAATTCCAATATAGATAAACATTATGGCTGGTTCATGACTGAATACACTACTGTCCAACCTCGTACGGTATAA

Network for GWHGAAZE012638

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	37	170	7.10E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.527
	SRR3591706	second leaf	0.425
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	1.342
	SRR3591709	Stem	0.475
	SRR3591710	White floral bud	2.850
	SRR3591711	White flower	0.805
	SRR3591712	Green floral bud	5.275
	SRR3591713	Yellow flower	0.102
SRP173429	SRR8316895	Juvenile bud stage	1.028
	SRR8316896	Juvenile bud stage	2.429
	SRR8316897	Juvenile bud stage	0.623
	SRR8316894	Third green stage	1.224
	SRR8316900	Third green stage	2.995
	SRR8316901	Third green stage	4.919
	SRR8316898	Complete white stage	0.050
	SRR8316899	Complete white stage	1.336
	SRR8316903	Complete white stage	0.508
	SRR8316902	Silver flowering stage	1.043
	SRR8316904	Silver flowering stage	0.472
	SRR8316905	Silver flowering stage	0.180
	SRR8316906	Gold flowering stage	0.245
	SRR8316907	Gold flowering stage	0.669
	SRR8316908	Gold flowering stage	0.531
SRP132670	SRR6706286	Control	3.493
	SRR6706287	Light intensity 50%	2.208
	SRR6706288	Light intensity 20%	1.844
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.934
	CNS0095593	Slightly white alabastrum(diploid) 2	1.826
	CNS0095594	Slightly white alabastrum(diploid) 3	5.264
	CNS0095595	Whole white alabastrum(diploid) 2	4.594
	CNS0095596	Whole white alabastrum(diploid) 3	6.108
	CNS0095597	Whole white alabastrum(diploid) 4	6.961
	CNS0095598	Silvery flower (diploied) 1	3.297
	CNS0095599	Silvery flower (diploied) 2	1.361
	CNS0095600	Silvery flower (diploied) 3	0.854
	CNS0095601	Golden flower (diploid) 1	3.205
	CNS0095602	Golden flower (diploid) 2	1.679
	CNS0095603	Golden flower (diploid) 3	0.925
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.435
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.503
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.294
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.595
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.175
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.813
	CNS0095610	Silvery flower (tetraploid) 1	0.216
	CNS0095611	Silvery flower (tetraploid) 2	0.397
	CNS0095612	Silvery flower (tetraploid) 3	0.726
	CNS0095613	Golden flower (tetraploid) 1	0.240
	CNS0095614	Golden flower (tetraploid) 2	0.158
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	1.568
	CRR073298	Stem 2	2.327
	CRR073299	Stem 3	1.239
	CRR073300	Leaf 1	2.581
	CRR073301	Leaf 2	1.523
	CRR073302	Leaf 3	1.169
	CRR073303	Juvenile bud 1	0.918
	CRR073304	Juvenile bud 2	1.326
	CRR073305	Juvenile bud 3	0.580
	CRR073306	Third green 1	0.093
	CRR073307	Third green 2	0.075
	CRR073308	Third green 3	0.277
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.207
	CRR073311	Second white 3	0.100
	CRR073312	Silver flowering 1	0.353
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	1.009
	CRR073315	Gold flowering 1	0.365
	CRR073316	Gold flowering 2	0.699
	CRR073317	Gold flowering 3	1.062
	CRR073318	Tawny withering 1	1.602
	CRR073319	Tawny withering 2	0.478
	CRR073320	Tawny withering 3	0.280