Gene detail

Detail information of GWHGAAZE012911

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDO99813.1	2.3279E-136	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q84K00\|NAC78_ARATH	6E-92	NAC domain-containing protein 78
trEMBL	tr\|A0A068TWS9\|A0A068TWS9_COFCA	9E-137	Coffea canephora DH200=94 genomic scaffold, scaffold_4 {ECO:0000313\|EMBL:CDO99813.1}
TAIR10	AT5G04410.1	5E-74	NAC domain containing protein 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	93656188	93659592	-
GWHAAZE00000003	mRNA	93656188	93659592	-
GWHAAZE00000003	exon	93656188	93656445	-
GWHAAZE00000003	exon	93657205	93657482	-
GWHAAZE00000003	exon	93659388	93659592	-
GWHAAZE00000003	CDS	93659388	93659592	-
GWHAAZE00000003	CDS	93657205	93657482	-
GWHAAZE00000003	CDS	93656188	93656445	-

Transcript Sequence
>GWHTAAZE012925 ATGGGTCACGAATCGGTGGCTTCAAAACCATCGTCGTCGTCATCAGCACCCAATACGACGTCGCTTGCTCCGGGATTTCGGTTCCATCCAACGGACGAGGAGCTGGTGAGGTACTATCTTACGCGCAAGGCATGTGGGAAGCCCTTTCGATTTCAAGCTGTTTCCGAAATCGATGTCTACAAATCCGAGCCTTGGGAACTTTCAGATTATTCGTCACTGAAGACCAGAGATCTAGAATGGTATTTCTTCAGCCCCGTAGATAGAAAATACGGCAATGGGTCTCGACTGAACCGAGCTACTGGGAAAGGTTACTGGAAGGCAACTGGGAAGGACCGACCTGTACGCCATAAGGGTCAGACCATTGGGATGAAAAAAACACTCGTCTTCCATAGTGGAAGAGCACCAGATGGAAAGCGAACCAACTGGGTAATGCACGAGTATAGACTTGTGGATCAAGAATTGATTAAAGCTGGAGTAGCACAGGGAAAGGATGCATTTGTGCTGTGCAGAATCTTTCAGAAGAGTGGTTTAGGACCACCAAACGGGGACCGGTATGCACCATTTTTGGAGGAGGAATGGGACGATGATGCAGCCCTCTTTGTTCCAGGAGGCGAGGCAGAGGCAGAGGATGATATGGCCAATGGTGATGATGGACGGGTTGAAGGAAATGACATCGAGCAGGTATATGCTTTTTGCGTACTTTATGCATCTGATCTTGGACTTCCTTTAAGTGTGATATGA

Network for GWHGAAZE012911

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	24	149	1.90E-36

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.683
	SRR3591706	second leaf	13.335
	SRR3591707	mature leaf	14.765
	SRR3591708	Shoot apex	11.505
	SRR3591709	Stem	25.085
	SRR3591710	White floral bud	12.300
	SRR3591711	White flower	18.210
	SRR3591712	Green floral bud	12.234
	SRR3591713	Yellow flower	20.556
SRP173429	SRR8316895	Juvenile bud stage	16.375
	SRR8316896	Juvenile bud stage	19.912
	SRR8316897	Juvenile bud stage	9.423
	SRR8316894	Third green stage	6.006
	SRR8316900	Third green stage	12.551
	SRR8316901	Third green stage	16.753
	SRR8316898	Complete white stage	6.395
	SRR8316899	Complete white stage	21.241
	SRR8316903	Complete white stage	11.473
	SRR8316902	Silver flowering stage	10.154
	SRR8316904	Silver flowering stage	13.925
	SRR8316905	Silver flowering stage	9.052
	SRR8316906	Gold flowering stage	25.244
	SRR8316907	Gold flowering stage	22.279
	SRR8316908	Gold flowering stage	21.528
SRP132670	SRR6706286	Control	21.606
	SRR6706287	Light intensity 50%	19.835
	SRR6706288	Light intensity 20%	19.701
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.246
	CNS0095593	Slightly white alabastrum(diploid) 2	11.801
	CNS0095594	Slightly white alabastrum(diploid) 3	10.700
	CNS0095595	Whole white alabastrum(diploid) 2	10.488
	CNS0095596	Whole white alabastrum(diploid) 3	6.151
	CNS0095597	Whole white alabastrum(diploid) 4	6.057
	CNS0095598	Silvery flower (diploied) 1	18.694
	CNS0095599	Silvery flower (diploied) 2	18.004
	CNS0095600	Silvery flower (diploied) 3	22.753
	CNS0095601	Golden flower (diploid) 1	17.238
	CNS0095602	Golden flower (diploid) 2	27.198
	CNS0095603	Golden flower (diploid) 3	27.216
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.610
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.106
	CNS0095606	Slightly white alabastrum(tetraploid) 3	15.876
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.923
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.955
	CNS0095609	Whole white alabastrum(tetraploid) 3	10.348
	CNS0095610	Silvery flower (tetraploid) 1	30.153
	CNS0095611	Silvery flower (tetraploid) 2	26.348
	CNS0095612	Silvery flower (tetraploid) 3	13.306
	CNS0095613	Golden flower (tetraploid) 1	24.283
	CNS0095614	Golden flower (tetraploid) 2	31.780
	CNS0095615	Golden flower (tetraploid) 3	37.981
CRA001975	CRR073297	Stem 1	21.868
	CRR073298	Stem 2	19.486
	CRR073299	Stem 3	19.693
	CRR073300	Leaf 1	13.800
	CRR073301	Leaf 2	18.537
	CRR073302	Leaf 3	10.901
	CRR073303	Juvenile bud 1	12.622
	CRR073304	Juvenile bud 2	13.567
	CRR073305	Juvenile bud 3	18.188
	CRR073306	Third green 1	9.782
	CRR073307	Third green 2	10.694
	CRR073308	Third green 3	6.606
	CRR073309	Second white 1	9.361
	CRR073310	Second white 2	11.636
	CRR073311	Second white 3	13.733
	CRR073312	Silver flowering 1	20.792
	CRR073313	Silver flowering 2	22.167
	CRR073314	Silver flowering 3	17.612
	CRR073315	Gold flowering 1	27.050
	CRR073316	Gold flowering 2	37.066
	CRR073317	Gold flowering 3	22.327
	CRR073318	Tawny withering 1	18.836
	CRR073319	Tawny withering 2	17.512
	CRR073320	Tawny withering 3	19.529