Gene detail

Detail information of GWHGAAZE012926

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004249018.1	3.26609E-58	PREDICTED: calcium-binding protein CAST [Solanum lycopersicum]
Swissprot	tr\|Q09011\|CAST_SOLTU	3E-56	Calcium-binding protein CAST
trEMBL	tr\|K4D1R6\|K4D1R6_SOLLC	1E-58	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc10g074740.1.1}
TAIR10	AT4G20780.1	1E-41	calmodulin like 42

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	93892109	93892534	+
GWHAAZE00000003	mRNA	93892109	93892534	+
GWHAAZE00000003	exon	93892109	93892534	+
GWHAAZE00000003	CDS	93892109	93892534	+

Transcript Sequence
>GWHTAAZE012940 ATGCTTACAGTCGACGAACTCGCCCAAGCCCTTAACGTTCTAGGCCTGGACACAGAGCCTTCAGAATTGGAATCCATGGTCAGTTCCTACGTTCAACAGGACAACCCTGGCCTCACATTCGAGGACTTTGAAGCTTTGCACAGATCCCTCAATGATGTCTACTTCAAGGAGGAGGAAGTCAATGGTGCACCAACCAAACTGCAATCGCAAGAGGAGTTGGATCTGTCAGAGGCGTTCAAGGTTTTCGATGAGGATGGTGATGGTTTTATATCCGCTAGGGAGTTGCAGGTGGTCCTAAGGAAGCTAGGTTTCCCTGAAGGTGGGGAGATTGATGGAGTGGAGAGGATGATTTCTTGTGTTGATAGCAACCATGATGGCCGCGTCGATTTCTTCGAGTTCAAGGATATGATGCGCAGTGTTGTTGTC

Network for GWHGAAZE012926

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	75	138	2.10E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	47.625
	SRR3591706	second leaf	14.644
	SRR3591707	mature leaf	43.745
	SRR3591708	Shoot apex	9.793
	SRR3591709	Stem	62.385
	SRR3591710	White floral bud	26.447
	SRR3591711	White flower	32.321
	SRR3591712	Green floral bud	18.341
	SRR3591713	Yellow flower	25.123
SRP173429	SRR8316895	Juvenile bud stage	28.787
	SRR8316896	Juvenile bud stage	26.111
	SRR8316897	Juvenile bud stage	27.905
	SRR8316894	Third green stage	18.083
	SRR8316900	Third green stage	30.386
	SRR8316901	Third green stage	42.877
	SRR8316898	Complete white stage	35.471
	SRR8316899	Complete white stage	68.847
	SRR8316903	Complete white stage	44.149
	SRR8316902	Silver flowering stage	23.529
	SRR8316904	Silver flowering stage	21.966
	SRR8316905	Silver flowering stage	14.974
	SRR8316906	Gold flowering stage	67.103
	SRR8316907	Gold flowering stage	51.111
	SRR8316908	Gold flowering stage	73.208
SRP132670	SRR6706286	Control	41.580
	SRR6706287	Light intensity 50%	44.169
	SRR6706288	Light intensity 20%	43.395
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	55.408
	CNS0095593	Slightly white alabastrum(diploid) 2	69.076
	CNS0095594	Slightly white alabastrum(diploid) 3	68.928
	CNS0095595	Whole white alabastrum(diploid) 2	50.157
	CNS0095596	Whole white alabastrum(diploid) 3	31.643
	CNS0095597	Whole white alabastrum(diploid) 4	37.854
	CNS0095598	Silvery flower (diploied) 1	73.944
	CNS0095599	Silvery flower (diploied) 2	55.957
	CNS0095600	Silvery flower (diploied) 3	54.480
	CNS0095601	Golden flower (diploid) 1	73.315
	CNS0095602	Golden flower (diploid) 2	66.451
	CNS0095603	Golden flower (diploid) 3	69.285
	CNS0095604	Slightly white alabastrum(tetraploid) 1	8.294
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.485
	CNS0095606	Slightly white alabastrum(tetraploid) 3	9.290
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.597
	CNS0095608	Whole white alabastrum(tetraploid) 2	5.977
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.269
	CNS0095610	Silvery flower (tetraploid) 1	20.700
	CNS0095611	Silvery flower (tetraploid) 2	17.454
	CNS0095612	Silvery flower (tetraploid) 3	15.395
	CNS0095613	Golden flower (tetraploid) 1	28.019
	CNS0095614	Golden flower (tetraploid) 2	29.354
	CNS0095615	Golden flower (tetraploid) 3	27.327
CRA001975	CRR073297	Stem 1	47.684
	CRR073298	Stem 2	45.703
	CRR073299	Stem 3	51.450
	CRR073300	Leaf 1	54.203
	CRR073301	Leaf 2	77.514
	CRR073302	Leaf 3	100.687
	CRR073303	Juvenile bud 1	100.896
	CRR073304	Juvenile bud 2	98.470
	CRR073305	Juvenile bud 3	158.787
	CRR073306	Third green 1	211.697
	CRR073307	Third green 2	214.827
	CRR073308	Third green 3	176.432
	CRR073309	Second white 1	103.133
	CRR073310	Second white 2	70.258
	CRR073311	Second white 3	47.457
	CRR073312	Silver flowering 1	94.467
	CRR073313	Silver flowering 2	118.310
	CRR073314	Silver flowering 3	74.427
	CRR073315	Gold flowering 1	272.215
	CRR073316	Gold flowering 2	259.112
	CRR073317	Gold flowering 3	376.784
	CRR073318	Tawny withering 1	212.196
	CRR073319	Tawny withering 2	314.497
	CRR073320	Tawny withering 3	178.163