Gene detail

Detail information of GWHGAAZE013112

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP06623.1	1.0072E-76	unnamed protein product [Coffea canephora]
Swissprot	tr\|O80928\|DOF24_ARATH	3E-51	Dof zinc finger protein DOF2.4
trEMBL	tr\|A0A068UG68\|A0A068UG68_COFCA	4E-77	Coffea canephora DH200=94 genomic scaffold, scaffold_22 {ECO:0000313\|EMBL:CDP06623.1}
TAIR10	AT2G37590.1	1E-40	DNA binding with one finger 2.4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	96976013	96977492	-
GWHAAZE00000003	mRNA	96976013	96977492	-
GWHAAZE00000003	exon	96977439	96977492	-
GWHAAZE00000003	exon	96976927	96977201	-
GWHAAZE00000003	exon	96976013	96976313	-
GWHAAZE00000003	CDS	96977439	96977492	-
GWHAAZE00000003	CDS	96976927	96977201	-
GWHAAZE00000003	CDS	96976013	96976313	-

Transcript Sequence
>GWHTAAZE013126 ATGGATTTTTCCACCATCCCCTCTGCTTATCTTGATCAATCCAACTGGCACCAGCAACAAAACTATCAAAGTGGGAGCGGCGGATCAAATTCTCACCTTCCTCCACCACCACCACAGCCTCCAGGGCCTTCGCCTCCTCCTCAGCCTCATGGGGGCGGTGCTGGCTCGATCAGGCCAGGCTCCATGGTGGATCGAGCTCGGATGGCCAATATACCCTTGCCGGAAACCGCCCTAAAGTGCCCGAGATGCGAATCTACAAACACAAAGTTTTGTTACTTCAACAACTACAGTCTCACGCAGCCTAGACACTTTTGCAAGACTTGTAGAAGGTATTGGACGAGAGGGGGTGCTCTAAGGAATGTTCCGGTGGGAGGCGGCTGCAGAAGGAACAAACGAACAAAAGGAAGTAACTCAAAGTCTCCGGCCAGTAGCGGTGACCGCCAAAGTACACCTTCTGCTTCAACAAGTACAACACTTGCTTTACCTAGTAGTGGTACCACAACAGCCAATATATTAGGCCTCACCTCACAATTCCCACAATTAAGGTTCATGGCACCACTAGGCCACCTTAGTGGCGAATACGGCGAAGTTGGCTTAAATTATGGCGCAGGCAGTGGGATTTCGGCTCCA

Network for GWHGAAZE013112

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02701.16	zf-Dof	77	132	2.50E-32

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2C2-Dof

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	17.709
	SRR3591706	second leaf	11.670
	SRR3591707	mature leaf	11.102
	SRR3591708	Shoot apex	16.426
	SRR3591709	Stem	15.279
	SRR3591710	White floral bud	13.233
	SRR3591711	White flower	13.588
	SRR3591712	Green floral bud	9.880
	SRR3591713	Yellow flower	7.532
SRP173429	SRR8316895	Juvenile bud stage	4.009
	SRR8316896	Juvenile bud stage	3.250
	SRR8316897	Juvenile bud stage	1.504
	SRR8316894	Third green stage	3.249
	SRR8316900	Third green stage	4.572
	SRR8316901	Third green stage	4.973
	SRR8316898	Complete white stage	3.293
	SRR8316899	Complete white stage	7.396
	SRR8316903	Complete white stage	4.575
	SRR8316902	Silver flowering stage	2.559
	SRR8316904	Silver flowering stage	2.210
	SRR8316905	Silver flowering stage	1.150
	SRR8316906	Gold flowering stage	2.938
	SRR8316907	Gold flowering stage	3.509
	SRR8316908	Gold flowering stage	3.478
SRP132670	SRR6706286	Control	4.576
	SRR6706287	Light intensity 50%	4.075
	SRR6706288	Light intensity 20%	4.279
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.845
	CNS0095593	Slightly white alabastrum(diploid) 2	5.137
	CNS0095594	Slightly white alabastrum(diploid) 3	1.511
	CNS0095595	Whole white alabastrum(diploid) 2	3.511
	CNS0095596	Whole white alabastrum(diploid) 3	1.585
	CNS0095597	Whole white alabastrum(diploid) 4	3.745
	CNS0095598	Silvery flower (diploied) 1	3.497
	CNS0095599	Silvery flower (diploied) 2	1.367
	CNS0095600	Silvery flower (diploied) 3	3.548
	CNS0095601	Golden flower (diploid) 1	2.273
	CNS0095602	Golden flower (diploid) 2	3.286
	CNS0095603	Golden flower (diploid) 3	3.687
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.735
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.701
	CNS0095606	Slightly white alabastrum(tetraploid) 3	11.823
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.972
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.625
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.601
	CNS0095610	Silvery flower (tetraploid) 1	6.858
	CNS0095611	Silvery flower (tetraploid) 2	5.366
	CNS0095612	Silvery flower (tetraploid) 3	4.415
	CNS0095613	Golden flower (tetraploid) 1	1.324
	CNS0095614	Golden flower (tetraploid) 2	4.982
	CNS0095615	Golden flower (tetraploid) 3	4.635
CRA001975	CRR073297	Stem 1	2.878
	CRR073298	Stem 2	3.732
	CRR073299	Stem 3	6.621
	CRR073300	Leaf 1	2.856
	CRR073301	Leaf 2	3.777
	CRR073302	Leaf 3	2.695
	CRR073303	Juvenile bud 1	2.921
	CRR073304	Juvenile bud 2	3.150
	CRR073305	Juvenile bud 3	3.698
	CRR073306	Third green 1	3.808
	CRR073307	Third green 2	5.036
	CRR073308	Third green 3	5.676
	CRR073309	Second white 1	0.960
	CRR073310	Second white 2	1.930
	CRR073311	Second white 3	2.588
	CRR073312	Silver flowering 1	1.294
	CRR073313	Silver flowering 2	2.025
	CRR073314	Silver flowering 3	0.515
	CRR073315	Gold flowering 1	0.872
	CRR073316	Gold flowering 2	2.696
	CRR073317	Gold flowering 3	0.120
	CRR073318	Tawny withering 1	6.472
	CRR073319	Tawny withering 2	2.978
	CRR073320	Tawny withering 3	8.911