Gene detail

Detail information of GWHGAAZE013206

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007027417.1	1.0402E-130	Transcription factor DP [Theobroma cacao]
Swissprot	tr\|Q9FNY2\|DPB_ARATH	6E-101	Transcription factor-like protein DPB
trEMBL	tr\|A0A061F077\|A0A061F077_THECC	4E-131	Transcription factor DP {ECO:0000313\|EMBL:EOY07919.1}
TAIR10	AT5G03415.1	1E-72	Transcription factor DP

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	98613002	98618058	+
GWHAAZE00000003	mRNA	98613002	98618058	+
GWHAAZE00000003	exon	98613002	98613055	+
GWHAAZE00000003	exon	98614026	98614116	+
GWHAAZE00000003	exon	98614338	98614381	+
GWHAAZE00000003	exon	98615338	98615400	+
GWHAAZE00000003	exon	98616501	98616644	+
GWHAAZE00000003	exon	98616741	98616809	+
GWHAAZE00000003	exon	98617380	98617450	+
GWHAAZE00000003	exon	98617824	98618058	+
GWHAAZE00000003	CDS	98613002	98613055	+
GWHAAZE00000003	CDS	98614026	98614116	+
GWHAAZE00000003	CDS	98614338	98614381	+
GWHAAZE00000003	CDS	98615338	98615400	+
GWHAAZE00000003	CDS	98616501	98616644	+
GWHAAZE00000003	CDS	98616741	98616809	+
GWHAAZE00000003	CDS	98617380	98617450	+
GWHAAZE00000003	CDS	98617824	98618058	+

Transcript Sequence
>GWHTAAZE013220 ATGATCGACGGCTCTTGGTACTCTGAAAGGAAACCTAATTCCAGGTGGCCTAAGCTGATAAACAGGAACAGGAAGAAGAAAAGAGGTCAACGTGCAGGTGGAGGGGATAAGAGTGGAAGGGGACTCCGCCAATTTAGCATGAAAGTGTGTGAGAAAGTGGAAAGCAAGGGAAGAACCACTTATAATGAGGTTGCAGATGAACTTGTTGCTGAATTTGCAGATCCGAGCAGTAGTGCTGCAGCACCAGACCAGCAATATGAAGAGAAAAACATTCGCCGAAGGGTCTATGATGCCCTAAACGTTCTCATGGCTATGGATATAATTTCTAAAGATAAGAAAGAAATACAATGGAAGGGTTTGCCTCGAACTAGCTTGAATGATATTGAAGAGCTAAAGAATGATCGCCTTGCACTACGAAATAGGATTGAAAAGAAGGCAGCCTATTTGCAAGAACTGGAAGAGCAAACTCGGCCTCATGCAACTGTGGAGGTGGAAATATCAGAAGATATGCAACTTGTACATTTTGACTTCAATAGCACCCCATTTGAACTACACGACGATAATTACGTTCTCAAGGCAATGAAATTTCACGAAACCCCACAGGCTGATAATATGGCACTGACGGTCCCACTAGATGGACGGGAAGACACCAGCGGGCCCGCCATTTTCCAACCACAAATCCCTCCTTCACGGTTGAATGTACCAGGTAGGCCCCCTACCTCACCTCCCGTACCTGGTATCCTCAAGGCTCGTCTCAAGCATGATAATTAA

Network for GWHGAAZE013206

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02319.21	E2F_TDP	40	119	1.40E-20
PF08781.11	DP	155	199	3.40E-15

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	E2F-DP

KEGG pathway

KO	Enzyme	pathway	mapID
K04683	TFDP1	TGF-beta signaling pathway	map04350
K04683	TFDP1	Cell cycle	map04110

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005667	cellular_component	transcription regulator complex
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.751
	SRR3591706	second leaf	4.208
	SRR3591707	mature leaf	3.492
	SRR3591708	Shoot apex	8.287
	SRR3591709	Stem	4.842
	SRR3591710	White floral bud	4.941
	SRR3591711	White flower	5.199
	SRR3591712	Green floral bud	4.014
	SRR3591713	Yellow flower	1.940
SRP173429	SRR8316895	Juvenile bud stage	3.870
	SRR8316896	Juvenile bud stage	4.967
	SRR8316897	Juvenile bud stage	1.112
	SRR8316894	Third green stage	2.598
	SRR8316900	Third green stage	4.325
	SRR8316901	Third green stage	3.992
	SRR8316898	Complete white stage	1.602
	SRR8316899	Complete white stage	5.346
	SRR8316903	Complete white stage	2.435
	SRR8316902	Silver flowering stage	1.407
	SRR8316904	Silver flowering stage	1.761
	SRR8316905	Silver flowering stage	0.518
	SRR8316906	Gold flowering stage	2.141
	SRR8316907	Gold flowering stage	2.886
	SRR8316908	Gold flowering stage	3.359
SRP132670	SRR6706286	Control	4.704
	SRR6706287	Light intensity 50%	4.045
	SRR6706288	Light intensity 20%	4.734
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	4.971
	CNS0095593	Slightly white alabastrum(diploid) 2	4.007
	CNS0095594	Slightly white alabastrum(diploid) 3	3.681
	CNS0095595	Whole white alabastrum(diploid) 2	3.799
	CNS0095596	Whole white alabastrum(diploid) 3	3.314
	CNS0095597	Whole white alabastrum(diploid) 4	3.193
	CNS0095598	Silvery flower (diploied) 1	4.779
	CNS0095599	Silvery flower (diploied) 2	3.487
	CNS0095600	Silvery flower (diploied) 3	2.242
	CNS0095601	Golden flower (diploid) 1	3.593
	CNS0095602	Golden flower (diploid) 2	3.333
	CNS0095603	Golden flower (diploid) 3	4.579
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.724
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.297
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.792
	CNS0095607	Whole white alabastrum(tetraploid) 1	5.457
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.462
	CNS0095609	Whole white alabastrum(tetraploid) 3	5.333
	CNS0095610	Silvery flower (tetraploid) 1	5.508
	CNS0095611	Silvery flower (tetraploid) 2	4.054
	CNS0095612	Silvery flower (tetraploid) 3	5.235
	CNS0095613	Golden flower (tetraploid) 1	1.912
	CNS0095614	Golden flower (tetraploid) 2	2.205
	CNS0095615	Golden flower (tetraploid) 3	2.187
CRA001975	CRR073297	Stem 1	6.131
	CRR073298	Stem 2	5.150
	CRR073299	Stem 3	6.208
	CRR073300	Leaf 1	4.538
	CRR073301	Leaf 2	3.273
	CRR073302	Leaf 3	3.070
	CRR073303	Juvenile bud 1	2.526
	CRR073304	Juvenile bud 2	1.491
	CRR073305	Juvenile bud 3	3.268
	CRR073306	Third green 1	1.475
	CRR073307	Third green 2	1.340
	CRR073308	Third green 3	2.194
	CRR073309	Second white 1	3.034
	CRR073310	Second white 2	1.976
	CRR073311	Second white 3	2.102
	CRR073312	Silver flowering 1	1.700
	CRR073313	Silver flowering 2	1.422
	CRR073314	Silver flowering 3	1.118
	CRR073315	Gold flowering 1	2.012
	CRR073316	Gold flowering 2	2.057
	CRR073317	Gold flowering 3	2.223
	CRR073318	Tawny withering 1	6.378
	CRR073319	Tawny withering 2	6.225
	CRR073320	Tawny withering 3	5.829