Gene detail

Detail information of GWHGAAZE013226

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU38572.1	2.842E-64	hypothetical protein MIMGU_mgv1a011717mg [Erythranthe guttata]
Swissprot	tr\|F4JIK2\|ATCA4_ARATH	4E-46	Alpha carbonic anhydrase 4 (Precursor)
trEMBL	tr\|A0A022RDX7\|A0A022RDX7_ERYGU	1E-64	Uncharacterized protein {ECO:0000313\|EMBL:EYU38572.1}
TAIR10	AT4G20990.1	3E-38	alpha carbonic anhydrase 4

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	98989128	98992166	+
GWHAAZE00000003	mRNA	98989128	98992166	+
GWHAAZE00000003	exon	98989128	98989258	+
GWHAAZE00000003	exon	98991486	98991600	+
GWHAAZE00000003	exon	98991948	98992166	+
GWHAAZE00000003	CDS	98989128	98989258	+
GWHAAZE00000003	CDS	98991486	98991600	+
GWHAAZE00000003	CDS	98991948	98992166	+

Transcript Sequence
>GWHTAAZE013240 ATGTTTGCAAATGCATGCGCGCAGCTTCAATGGGAAGGTGATGCTGGATCAGTTCGAATCAACGGCTCCGATTACACTCTCCGACAGGCCCATTGGCACTCTCCTTCGGAGCACACCATCAATGGCAGAAGGTATGACATGGAACTACACATGGTTCATTCAAGTACAGACCCCAACTTGAAAAACCAGATAGCAGTTACTGGTGTACTATACAAAATTGGTCATCCAGATTCATTTCTCTCTAAGCTGGCTACAAATATATCATCTATGGTTGATGCAAATAATCATCAACACACAAGATATGGGGTGATGGATCCAAGAAAGATTAAGACAAATGGTAAAATGTGCTATAGATACATGGGCTCACTCACTGTTCCACCTTGTACTGAAGGTGTCATTTGGACCATTGATAAAAAGGTAAGTACACGTCTCATCAATATAATTAGTGCAATGGTATATTTATAG

Network for GWHGAAZE013226

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00194.22	Carb_anhydrase	23	140	9.00E-24

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01674	cah	Metabolic pathways	map01100
K01674	cah	Nitrogen metabolism	map00910

Gene Ontology

GO term	Ontology	Name
GO:0004089	molecular_function	carbonate dehydratase activity
GO:0008270	molecular_function	zinc ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.203
	SRR3591706	second leaf	0.125
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.911
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.308
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.071
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.083
	SRR8316896	Juvenile bud stage	0.033
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.064
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.527
	SRR8316907	Gold flowering stage	0.433
	SRR8316908	Gold flowering stage	0.108
SRP132670	SRR6706286	Control	0.114
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.057
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.243
	CNS0095593	Slightly white alabastrum(diploid) 2	0.061
	CNS0095594	Slightly white alabastrum(diploid) 3	0.055
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.169
	CNS0095597	Whole white alabastrum(diploid) 4	0.087
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.010
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.116
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.126
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.737
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.240
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.230
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.048
	CNS0095612	Silvery flower (tetraploid) 3	0.053
	CNS0095613	Golden flower (tetraploid) 1	0.134
	CNS0095614	Golden flower (tetraploid) 2	0.111
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.061
	CRR073301	Leaf 2	0.094
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.121
	CRR073313	Silver flowering 2	0.011
	CRR073314	Silver flowering 3	0.179
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.007
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.177
	CRR073320	Tawny withering 3	0.000