Gene detail

Detail information of GWHGAAZE013282

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDP42725.1	1.40208E-80	hypothetical protein JCGZ_23665 [Jatropha curcas]
Swissprot	tr\|Q9SJM7\|URH1_ARATH	1E-77	Uridine nucleosidase 1
trEMBL	tr\|A0A067LE21\|A0A067LE21_JATCU	5E-81	Uncharacterized protein {ECO:0000313\|EMBL:KDP42725.1}
TAIR10	AT2G36310.1	2E-63	uridine-ribohydrolase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	100008807	100010627	+
GWHAAZE00000003	mRNA	100008807	100010627	+
GWHAAZE00000003	exon	100008807	100008903	+
GWHAAZE00000003	exon	100009012	100009119	+
GWHAAZE00000003	exon	100009263	100009398	+
GWHAAZE00000003	exon	100010513	100010627	+
GWHAAZE00000003	CDS	100008807	100008903	+
GWHAAZE00000003	CDS	100009012	100009119	+
GWHAAZE00000003	CDS	100009263	100009398	+
GWHAAZE00000003	CDS	100010513	100010627	+

Transcript Sequence
>GWHTAAZE013296 ATTTATGGTGACCCAGAAGCAGCAGATATTGTGTTCACCTGTGTGGCCAATATTGTTGTTGTCGGCATAAACATTACAACACAAGTCCAATTGACAGATCATGATCTCGATGAATTGAAGAAGTCCGGAGGAAAACACGCTCAATTCTTGAGTGACATGATGAAATTCTATCGTGATTGGCACGTAAAATCTGATGGTGTATATGGAATTTTTCTTCACGATCCCGTCAGTTTTGTGGCGTTAGTTCGGCCGGACCTCTTCACATACAAGGTGGGGGTTGTGAGGGTTGAGACTCAAGGCATCTGCTTAGGCCATACGCTAATGGACCAAGGCCTAAAAAGATACAGATGGAATTCAGACAACCCGTGGTCAGGCTGTTCCCCCATTTCAGTTGCATGGACAGTTGATGTCAAAGAGGTTGTCGATTACATCAAAAACCGGTTAATGACAGCATGA

Network for GWHGAAZE013282

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01156.20	IU_nuc_hydro	1	141	1.90E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01240	URH1	Metabolic pathways	map01100
		Pyrimidine metabolism	map00240
		Nicotinate and nicotinamide metabolism	map00760

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.020
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.446
	SRR3591709	Stem	0.570
	SRR3591710	White floral bud	0.545
	SRR3591711	White flower	0.089
	SRR3591712	Green floral bud	1.217
	SRR3591713	Yellow flower	1.022
SRP173429	SRR8316895	Juvenile bud stage	0.216
	SRR8316896	Juvenile bud stage	1.705
	SRR8316897	Juvenile bud stage	4.902
	SRR8316894	Third green stage	0.394
	SRR8316900	Third green stage	1.180
	SRR8316901	Third green stage	0.499
	SRR8316898	Complete white stage	0.103
	SRR8316899	Complete white stage	0.227
	SRR8316903	Complete white stage	0.322
	SRR8316902	Silver flowering stage	0.600
	SRR8316904	Silver flowering stage	0.133
	SRR8316905	Silver flowering stage	0.231
	SRR8316906	Gold flowering stage	0.169
	SRR8316907	Gold flowering stage	0.481
	SRR8316908	Gold flowering stage	1.073
SRP132670	SRR6706286	Control	1.391
	SRR6706287	Light intensity 50%	1.870
	SRR6706288	Light intensity 20%	1.348
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.834
	CNS0095593	Slightly white alabastrum(diploid) 2	0.190
	CNS0095594	Slightly white alabastrum(diploid) 3	1.143
	CNS0095595	Whole white alabastrum(diploid) 2	0.442
	CNS0095596	Whole white alabastrum(diploid) 3	1.059
	CNS0095597	Whole white alabastrum(diploid) 4	1.145
	CNS0095598	Silvery flower (diploied) 1	0.343
	CNS0095599	Silvery flower (diploied) 2	0.395
	CNS0095600	Silvery flower (diploied) 3	0.892
	CNS0095601	Golden flower (diploid) 1	1.017
	CNS0095602	Golden flower (diploid) 2	1.306
	CNS0095603	Golden flower (diploid) 3	0.897
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.674
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.292
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.184
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.902
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.066
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.166
	CNS0095610	Silvery flower (tetraploid) 1	0.102
	CNS0095611	Silvery flower (tetraploid) 2	0.210
	CNS0095612	Silvery flower (tetraploid) 3	0.194
	CNS0095613	Golden flower (tetraploid) 1	2.568
	CNS0095614	Golden flower (tetraploid) 2	1.575
	CNS0095615	Golden flower (tetraploid) 3	0.381
CRA001975	CRR073297	Stem 1	0.103
	CRR073298	Stem 2	0.224
	CRR073299	Stem 3	0.142
	CRR073300	Leaf 1	0.200
	CRR073301	Leaf 2	0.374
	CRR073302	Leaf 3	0.176
	CRR073303	Juvenile bud 1	0.208
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.028
	CRR073306	Third green 1	0.287
	CRR073307	Third green 2	0.830
	CRR073308	Third green 3	0.121
	CRR073309	Second white 1	0.048
	CRR073310	Second white 2	0.443
	CRR073311	Second white 3	0.577
	CRR073312	Silver flowering 1	0.105
	CRR073313	Silver flowering 2	0.109
	CRR073314	Silver flowering 3	0.136
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.400
	CRR073317	Gold flowering 3	0.023
	CRR073318	Tawny withering 1	3.139
	CRR073319	Tawny withering 2	3.781
	CRR073320	Tawny withering 3	1.761