Gene detail

Detail information of GWHGAAZE013292

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AEV91543.1	2.2046E-129	starch branching enzyme [Cucurbita moschata]
Swissprot	tr\|Q9LZS3\|GLGB2_ARATH	8E-126	1,4-alpha-glucan-branching enzyme 2-2, chloroplastic/amyloplastic (Precursor)
trEMBL	tr\|G9JJR0\|G9JJR0_CUCMO	8E-130	Starch branching enzyme {ECO:0000313\|EMBL:AEV91543.1} (Fragment)
TAIR10	AT5G03650.1	3E-105	starch branching enzyme 2.2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	100188264	100191938	+
GWHAAZE00000003	mRNA	100188264	100191938	+
GWHAAZE00000003	exon	100188264	100188323	+
GWHAAZE00000003	exon	100188420	100188500	+
GWHAAZE00000003	exon	100189175	100189291	+
GWHAAZE00000003	exon	100189694	100189777	+
GWHAAZE00000003	exon	100191159	100191280	+
GWHAAZE00000003	exon	100191815	100191938	+
GWHAAZE00000003	CDS	100188264	100188323	+
GWHAAZE00000003	CDS	100188420	100188500	+
GWHAAZE00000003	CDS	100189175	100189291	+
GWHAAZE00000003	CDS	100189694	100189777	+
GWHAAZE00000003	CDS	100191159	100191280	+
GWHAAZE00000003	CDS	100191815	100191938	+

Transcript Sequence
>GWHTAAZE013306 TCGGCGGCACTTATTGGAGATTTCAACAACTGGAATCCTAATGCTGATATTATGACCCGGAATGAGTTTGGCGTGTGGGAGATCTTTTTGCCAAATAATGTAGATGGTTCTCCACCAATTCCCCATGGCTCACGAGTGAAGATCCGAATGGATACTCCATCTGGCATTAAGGACTCCATTCCTGCCTGGATCAAGTTCTCTGTGCAGGCACCTGGTGAAATACCATATAATGGAATCTACTATGATCCACCAGAAGAGGATAAGTATGTGTTCCAACATCCACGCCCAAAGAAACCAACATCCCTTAGGATTTACGAGGCACATGTTGGAATGAGTAGTACGGAGCCAATTATAAGCACATATACAAACTTTAGAGATGATATGCTCCCTCGCATAAAAAAGCTTGGTTATAATGCAGTGCAGCTTATGGCCATCCAAGAACATTCATATTATGCTAGCTTTGGGTACCACGTGACAAATTTCTTTGCACCAAGTAGCCGATGTGGGACTCCTGATGATCTCAAGTCTTTGATAGATAGAGCTCATGAGTTAGGATTGCTTGTTCTCATGGATATAGTCCACAGGTAA

Network for GWHGAAZE013292

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02922.19	CBM_48	2	63	1.30E-10
PF00128.25	Alpha-amylase	129	193	8.10E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00700	GBE1, glgB	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Starch and sucrose metabolism	map00500

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0003824	molecular_function	catalytic activity
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	136.432
	SRR3591706	second leaf	145.277
	SRR3591707	mature leaf	144.485
	SRR3591708	Shoot apex	56.054
	SRR3591709	Stem	226.023
	SRR3591710	White floral bud	127.299
	SRR3591711	White flower	231.283
	SRR3591712	Green floral bud	106.116
	SRR3591713	Yellow flower	198.417
SRP173429	SRR8316895	Juvenile bud stage	53.161
	SRR8316896	Juvenile bud stage	63.301
	SRR8316897	Juvenile bud stage	25.325
	SRR8316894	Third green stage	39.947
	SRR8316900	Third green stage	108.165
	SRR8316901	Third green stage	95.957
	SRR8316898	Complete white stage	44.219
	SRR8316899	Complete white stage	143.294
	SRR8316903	Complete white stage	83.594
	SRR8316902	Silver flowering stage	46.585
	SRR8316904	Silver flowering stage	67.713
	SRR8316905	Silver flowering stage	34.687
	SRR8316906	Gold flowering stage	134.258
	SRR8316907	Gold flowering stage	130.017
	SRR8316908	Gold flowering stage	106.042
SRP132670	SRR6706286	Control	111.073
	SRR6706287	Light intensity 50%	133.105
	SRR6706288	Light intensity 20%	147.236
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.039
	CNS0095593	Slightly white alabastrum(diploid) 2	20.977
	CNS0095594	Slightly white alabastrum(diploid) 3	20.194
	CNS0095595	Whole white alabastrum(diploid) 2	21.336
	CNS0095596	Whole white alabastrum(diploid) 3	21.173
	CNS0095597	Whole white alabastrum(diploid) 4	23.063
	CNS0095598	Silvery flower (diploied) 1	31.686
	CNS0095599	Silvery flower (diploied) 2	31.355
	CNS0095600	Silvery flower (diploied) 3	114.372
	CNS0095601	Golden flower (diploid) 1	29.691
	CNS0095602	Golden flower (diploid) 2	93.943
	CNS0095603	Golden flower (diploid) 3	89.189
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.037
	CNS0095605	Slightly white alabastrum(tetraploid) 2	24.066
	CNS0095606	Slightly white alabastrum(tetraploid) 3	139.472
	CNS0095607	Whole white alabastrum(tetraploid) 1	20.641
	CNS0095608	Whole white alabastrum(tetraploid) 2	14.492
	CNS0095609	Whole white alabastrum(tetraploid) 3	116.156
	CNS0095610	Silvery flower (tetraploid) 1	88.765
	CNS0095611	Silvery flower (tetraploid) 2	122.252
	CNS0095612	Silvery flower (tetraploid) 3	88.968
	CNS0095613	Golden flower (tetraploid) 1	23.240
	CNS0095614	Golden flower (tetraploid) 2	78.948
	CNS0095615	Golden flower (tetraploid) 3	38.529
CRA001975	CRR073297	Stem 1	66.517
	CRR073298	Stem 2	70.446
	CRR073299	Stem 3	62.685
	CRR073300	Leaf 1	118.567
	CRR073301	Leaf 2	78.848
	CRR073302	Leaf 3	79.305
	CRR073303	Juvenile bud 1	94.997
	CRR073304	Juvenile bud 2	79.903
	CRR073305	Juvenile bud 3	119.645
	CRR073306	Third green 1	40.632
	CRR073307	Third green 2	24.821
	CRR073308	Third green 3	30.507
	CRR073309	Second white 1	40.011
	CRR073310	Second white 2	54.459
	CRR073311	Second white 3	54.996
	CRR073312	Silver flowering 1	32.854
	CRR073313	Silver flowering 2	26.243
	CRR073314	Silver flowering 3	28.983
	CRR073315	Gold flowering 1	51.263
	CRR073316	Gold flowering 2	117.795
	CRR073317	Gold flowering 3	44.784
	CRR073318	Tawny withering 1	35.098
	CRR073319	Tawny withering 2	23.679
	CRR073320	Tawny withering 3	34.024