Gene detail

Detail information of GWHGAAZE013393

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002524409.1	9.68485E-90	DNA-binding protein RAV1, putative [Ricinus communis]
Swissprot	tr\|Q9C6M5\|RAVL1_ARATH	3E-86	AP2/ERF and B3 domain-containing transcription repressor TEM1
trEMBL	tr\|B9SEJ0\|B9SEJ0_RICCO	4E-90	DNA-binding protein RAV1, putative {ECO:0000313\|EMBL:EEF38020.1}
TAIR10	AT1G25560.1	1E-63	AP2/B3 transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	101947329	101947850	-
GWHAAZE00000003	mRNA	101947329	101947850	-
GWHAAZE00000003	exon	101947329	101947850	-
GWHAAZE00000003	CDS	101947329	101947850	-

Transcript Sequence
>GWHTAAZE013407 ATGGGTAGCGGCAGCAGCGTGATTCTAGACCCCGACAGCTGTGTCGAAGCCGAATCCCGGAAACTCCCGTCCTCTCGATTCAAGGGAGTGGTCCCACAGCCAAACGGCCGATGGGGCGCCCAAATTTACGAAAAACACCAACGTGTTTGGCTGGGCACATTCAACGAAGAAGCCGAAGCTGCCAAAGCCTACGACATCGCCGCCAAGCGGTTCCGTGGAAACGACGCTGTCACCAACTTCAAGGCCCAAAACGACGACGAAATTGAAACTAGCTTCCTTAATTGTCACTCAAAGGCTGAGATCGTCGATATGCTTCGTAAACACACCTACATCGACGAGCTTCAACAGAGTGCTCGTAACTACAACTGCAGCGATGGAAATCGATCGTGTATAGAGAATAGATGTGAGCAGAATACAAAATCACGTGAAGGGTTATTTGAAAAGGCGGTGACACCGAGCGACGTGGGGAAGCTGAACAGGCTGGTGATACCGAAGCAGCATGCCGAAAAGCACTTTCCGTTG

Network for GWHGAAZE013393

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00847.21	AP2	25	73	1.30E-09

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	AP2/ERF-ERF

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	16.498
	SRR3591706	second leaf	9.528
	SRR3591707	mature leaf	11.256
	SRR3591708	Shoot apex	32.994
	SRR3591709	Stem	18.976
	SRR3591710	White floral bud	6.115
	SRR3591711	White flower	14.178
	SRR3591712	Green floral bud	1.291
	SRR3591713	Yellow flower	12.693
SRP173429	SRR8316895	Juvenile bud stage	1.204
	SRR8316896	Juvenile bud stage	2.828
	SRR8316897	Juvenile bud stage	0.468
	SRR8316894	Third green stage	1.774
	SRR8316900	Third green stage	0.806
	SRR8316901	Third green stage	0.996
	SRR8316898	Complete white stage	2.174
	SRR8316899	Complete white stage	1.928
	SRR8316903	Complete white stage	4.298
	SRR8316902	Silver flowering stage	3.205
	SRR8316904	Silver flowering stage	5.274
	SRR8316905	Silver flowering stage	2.866
	SRR8316906	Gold flowering stage	20.940
	SRR8316907	Gold flowering stage	14.340
	SRR8316908	Gold flowering stage	52.812
SRP132670	SRR6706286	Control	8.045
	SRR6706287	Light intensity 50%	9.456
	SRR6706288	Light intensity 20%	6.349
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	11.931
	CNS0095593	Slightly white alabastrum(diploid) 2	1.949
	CNS0095594	Slightly white alabastrum(diploid) 3	5.659
	CNS0095595	Whole white alabastrum(diploid) 2	3.233
	CNS0095596	Whole white alabastrum(diploid) 3	1.173
	CNS0095597	Whole white alabastrum(diploid) 4	0.791
	CNS0095598	Silvery flower (diploied) 1	16.129
	CNS0095599	Silvery flower (diploied) 2	4.569
	CNS0095600	Silvery flower (diploied) 3	7.944
	CNS0095601	Golden flower (diploid) 1	12.002
	CNS0095602	Golden flower (diploid) 2	16.549
	CNS0095603	Golden flower (diploid) 3	17.805
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.928
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.157
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.531
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.975
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.795
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.123
	CNS0095610	Silvery flower (tetraploid) 1	4.123
	CNS0095611	Silvery flower (tetraploid) 2	1.635
	CNS0095612	Silvery flower (tetraploid) 3	3.342
	CNS0095613	Golden flower (tetraploid) 1	19.083
	CNS0095614	Golden flower (tetraploid) 2	10.387
	CNS0095615	Golden flower (tetraploid) 3	15.851
CRA001975	CRR073297	Stem 1	6.552
	CRR073298	Stem 2	4.326
	CRR073299	Stem 3	8.302
	CRR073300	Leaf 1	1.675
	CRR073301	Leaf 2	1.858
	CRR073302	Leaf 3	2.444
	CRR073303	Juvenile bud 1	0.797
	CRR073304	Juvenile bud 2	1.391
	CRR073305	Juvenile bud 3	0.836
	CRR073306	Third green 1	0.280
	CRR073307	Third green 2	1.383
	CRR073308	Third green 3	3.317
	CRR073309	Second white 1	10.550
	CRR073310	Second white 2	9.705
	CRR073311	Second white 3	16.434
	CRR073312	Silver flowering 1	107.760
	CRR073313	Silver flowering 2	84.449
	CRR073314	Silver flowering 3	32.794
	CRR073315	Gold flowering 1	4.078
	CRR073316	Gold flowering 2	6.627
	CRR073317	Gold flowering 3	19.053
	CRR073318	Tawny withering 1	15.216
	CRR073319	Tawny withering 2	16.541
	CRR073320	Tawny withering 3	10.385