Gene detail

Detail information of GWHGAAZE013414

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU22604.1	9.74052E-78	hypothetical protein MIMGU_mgv1a015304mg [Erythranthe guttata]
Swissprot	tr\|Q9LI84\|CML16_ARATH	2E-72	Probable calcium-binding protein CML16
trEMBL	tr\|A0A022Q4P8\|A0A022Q4P8_ERYGU	4E-78	Uncharacterized protein {ECO:0000313\|EMBL:EYU22604.1}
TAIR10	AT3G25600.1	2E-49	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000003	gene	102293937	102294359	+
GWHAAZE00000003	mRNA	102293937	102294359	+
GWHAAZE00000003	exon	102293937	102294359	+
GWHAAZE00000003	CDS	102293937	102294359	+

Transcript Sequence
>GWHTAAZE013428 ATGGATTCCGACGGTAGCTTGACTTTATTAGAACTTGCGGCTCTTCTCCGATCTCTGGGTATAAAGCCAAAAGGTGAACAAATCCATGTTCTATTGAATAATATGGATGCAAATGGAAATGGGTCGATTGAGTTTGAAGAATTGGTCGCTGCGATTTTGGGTGATATGGAAGAGGAGGTACTGCTAAACCACGATCAATTAATGGAAGTTTTCCGGTCGTTCGATCGAGACGGTAACGGTTACATAACGGCTGCGGAACTCGCCGGACAGATGGCTAAGATGGGCCGGCCGTTGAATTATAAAGAGTTATCGGATATGATGAGAGAGGCTGACGCCAACGGTGACGGCGTTATAAGTTTCAACGAGTTCACGACGATTTTGGGAAAATCGGCGGTTGAATACCTCGGCCTCACCGTATCTTAG

Network for GWHGAAZE013414

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	2	51	3.40E-07
PF13499.7	EF-hand_7	65	126	7.50E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	21.581
	SRR3591706	second leaf	9.130
	SRR3591707	mature leaf	16.877
	SRR3591708	Shoot apex	11.793
	SRR3591709	Stem	30.041
	SRR3591710	White floral bud	22.800
	SRR3591711	White flower	16.423
	SRR3591712	Green floral bud	12.423
	SRR3591713	Yellow flower	5.008
SRP173429	SRR8316895	Juvenile bud stage	6.542
	SRR8316896	Juvenile bud stage	4.209
	SRR8316897	Juvenile bud stage	3.644
	SRR8316894	Third green stage	3.266
	SRR8316900	Third green stage	6.509
	SRR8316901	Third green stage	6.789
	SRR8316898	Complete white stage	4.203
	SRR8316899	Complete white stage	26.279
	SRR8316903	Complete white stage	9.212
	SRR8316902	Silver flowering stage	4.807
	SRR8316904	Silver flowering stage	4.889
	SRR8316905	Silver flowering stage	2.074
	SRR8316906	Gold flowering stage	9.523
	SRR8316907	Gold flowering stage	6.279
	SRR8316908	Gold flowering stage	8.976
SRP132670	SRR6706286	Control	5.016
	SRR6706287	Light intensity 50%	4.282
	SRR6706288	Light intensity 20%	3.894
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.708
	CNS0095593	Slightly white alabastrum(diploid) 2	13.855
	CNS0095594	Slightly white alabastrum(diploid) 3	11.143
	CNS0095595	Whole white alabastrum(diploid) 2	10.160
	CNS0095596	Whole white alabastrum(diploid) 3	9.244
	CNS0095597	Whole white alabastrum(diploid) 4	12.546
	CNS0095598	Silvery flower (diploied) 1	42.220
	CNS0095599	Silvery flower (diploied) 2	23.156
	CNS0095600	Silvery flower (diploied) 3	16.799
	CNS0095601	Golden flower (diploid) 1	41.744
	CNS0095602	Golden flower (diploid) 2	29.439
	CNS0095603	Golden flower (diploid) 3	24.888
	CNS0095604	Slightly white alabastrum(tetraploid) 1	12.173
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.064
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.235
	CNS0095607	Whole white alabastrum(tetraploid) 1	16.131
	CNS0095608	Whole white alabastrum(tetraploid) 2	16.685
	CNS0095609	Whole white alabastrum(tetraploid) 3	8.738
	CNS0095610	Silvery flower (tetraploid) 1	8.652
	CNS0095611	Silvery flower (tetraploid) 2	8.804
	CNS0095612	Silvery flower (tetraploid) 3	9.631
	CNS0095613	Golden flower (tetraploid) 1	9.158
	CNS0095614	Golden flower (tetraploid) 2	10.163
	CNS0095615	Golden flower (tetraploid) 3	10.123
CRA001975	CRR073297	Stem 1	13.926
	CRR073298	Stem 2	10.595
	CRR073299	Stem 3	13.150
	CRR073300	Leaf 1	9.407
	CRR073301	Leaf 2	13.676
	CRR073302	Leaf 3	11.095
	CRR073303	Juvenile bud 1	15.353
	CRR073304	Juvenile bud 2	18.251
	CRR073305	Juvenile bud 3	20.809
	CRR073306	Third green 1	13.550
	CRR073307	Third green 2	16.556
	CRR073308	Third green 3	12.142
	CRR073309	Second white 1	6.645
	CRR073310	Second white 2	11.357
	CRR073311	Second white 3	5.113
	CRR073312	Silver flowering 1	11.443
	CRR073313	Silver flowering 2	7.617
	CRR073314	Silver flowering 3	14.427
	CRR073315	Gold flowering 1	39.327
	CRR073316	Gold flowering 2	40.105
	CRR073317	Gold flowering 3	47.356
	CRR073318	Tawny withering 1	38.396
	CRR073319	Tawny withering 2	33.241
	CRR073320	Tawny withering 3	26.714